7900 real time pcr machine
The 7900 Real-Time PCR machine is a high-performance instrument designed for quantitative real-time PCR analysis. It features advanced optical detection technology and provides precise temperature control to enable accurate and sensitive nucleic acid quantification.
Lab products found in correlation
8 protocols using 7900 real time pcr machine
Quantitative Real-Time PCR of MXD3 Isoforms
Quantifying Bacterial Diversity via qPCR
qPCR analysis was carried out on a 7900 real-time PCR machine (Applied Biosystems, Foster City, CA, USA) using the Power SYBR Green PCR Master Mix (Applied Biosystems), where 40 ng of the DNA template was introduced in each reaction.
To achieve bacterial quantification, standard curves were developed using serial dilutions of a known DNA concentration corresponding to Escherichia coli (American Type Culture Collection [ATCC] 10536), L. plantarum (ATCC 8014), B. breve (ATCC 15700), and B. fragilis (DSM 2151). A bacterial universal primer pair was used to determine the bacterial load from each sample [33 (link)]. All samples were run in triplicate.
Quantification of miRNA Expression
centrifugation and total RNA was isolated using Trizol reagents (Invitrogen,
Shanghai, China) according to the manufacturer’s protocol. Quantification of
miRNA was conducted using the ALL-in-one miRNA real-time quantitative reverse
transcription polymerase chain reaction (qRT-PCR) detection kit (GeneCopeia,
Rockville, MD, USA). The assay was carried out on an Applied Biosystems 7900
Real Time PCR machine (Applied Biosystems, Foster City, CA, USA). The primers
used for qRT-PCR were miR-196a/b (5′-TAGGTAGTTTCCTGTTGTTGGG-3′) and U6
(5′-TTCGTGAAGCGTTCCATATTTT-3′). The reactions were incubated in a 96-well plate
at 95°C for 10 minutes, followed by 40 cycles of 95°C for 10 s, 58°C for 20 s,
and 72°C for 10 s. Relative quantification was calculated using the
2-ΔΔCT method16 (link) and U6 was used for normalization.
Quantifying Centromeric Plasmid Copy Number
Quantitative Analysis of CWMV Infection
Quantitative RT-PCR Analysis of Gene Expression
Quantitative RT-PCR Analysis of Gene Expression
The primers used in Qrt-PCR
Gene | Forward sequence (5ʹ-3ʹ) | Reverse sequence (5ʹ-3ʹ) |
---|---|---|
Sox2 | AGAACCCCAAGATGCACAAC | GGGCAGCGTGTACTTATCCT |
Oct4 | AGCGATCAAGCAGCGACTAT | AGAGTGGTGACGGAGACAGG |
β-actin | TGACGTGGACATCCGCAAAG | CTGGAAGGTGGACAGCGAGG |
Quantitative Real-Time PCR Assay for Gene Expression
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!