Qscript one step qrt pcr kit

Real-time RT-qPCR was performed in duplicates using the qScript One-step qRT-PCR Kit (Quanta Biosciences, Gaithersburg, MD, USA) in a final volume of 25 μL following the previously established protocol [32 (link)] and the reaction was carried out on a 7500 Fast Real-Time system cycler (Applied Biosystems, Foster City, CA, USA).

Cardiac myocytes were processed with GeneJet RNA Purification Kit (Thermo Fisher Scientific, Waltham, MA, USA) for extraction of total RNA. In total, 25 ng of extracted total RNA was used for all reactions and processed using a qScript One Step qRT PCR Kit (Quanta Biosciences, Beverly, MA, USA). Bio-Rad iQ5 real-time PCR thermocycler was used for amplification and analysis, with normalization to Gapdh, and relative gene expression calculated (2^−ΔΔCT method). Primer sequences were PGC-1α-forward 5′-AAGTGTGGAACTCTCTGGAACTG-3′, PGC-1α-reverse 5′-GGGTTATCTTGGTTGGCTTTATG-3′, Gapdh-forward 5′-TGCACCACCAACTGCTTAGC-3′, and Gapdh-reverse 5′-GGCATGGACTGTGGTCATGAG-3′.

Total RNA was extracted using the TRIzol reagent following manufacturers protocol (Invitrogen). 100 ng of total RNA was used in the qScript™ One-Step qRT-PCR Kit (Quanta Biosciences, Gaithersburg, MD). The RT-PCR reactions were performed on a CFX Connect™ Real-Time System (BioRad, Hercules, CA) under 48° C for 10 min; 95°C for 5 min for the first cycle; 95°C for 15 s, 55°C for 30 s for 40 cycles; 60 melt curve read offs from 65-95°C. ALAS-1 or POLR-2A mRNA expression were used for reference. To display relative gene expression, the ΔΔC_t formula [42 (link)] was used. The primers used were: ADRB2 fwd: gtcttgagggctttgtgctc, rev: ggcagctccagaagattgac; UGT2B15 fwd: gatcatcgaccccagagaaa, rev: tcactgtaaaccagccaaacc; UGT2B17 fwd: gatcatcgaccccagagaaa, rev: cgcccattcttaccaaatgt; Kallikrein 3/Prostate Specific Antigen (KLK3/PSA) fwd: ccctgagcacccctatcaac, rev: tgagtgtcggtgggttgtg.

Seedlings were grown as described for the mass spectrometry experiment using medium supplemented with natural abundance ammonium nitrate and potassium nitrate. The roots were dissected with a scalpel, and RNA was prepared using the QIAGEN RNeasy Plant Mini Kit (QIAGEN, Hilden, Germany). The RNA samples were treated with RQ1 DNase (Promega, Madison, WI) according to the instructions. This procedure was conducted at three non-overlapping times for a total of three biological replicates. cDNA synthesis and quantitative real-time PCR (qRT-PCR) were conducted simultaneously using a qScript™ One-Step qRT-PCR Kit (Quanta Biosciences, Gaithersburg, MD) as recommended. Four technical replicates per sample were included. The samples were run on a Roche Light Cycler 480 and analyzed using LinRegPCR (Ramakers et al., 2003 (link)). Reference genes with similar expression levels to the candidate genes were chosen (Czechowski et al., 2005 (link)); At1g58050 was used for AT4G23690 and GDH3, At4g27960 was used for MAJOR LATEX PROTEIN LIKE 1, and At1g13320 was used for all other genes.

For the FFA, pre-weighed tubes containing frozen organs were thawed, homogenized (Tissuelyser II; Qiagen), and centrifuged. The supernatant was serially diluted, added to BHK-21 cells, and the titers were determined as described above. Titers were expressed as the log FFU/g of tissue. For qRT-PCR, RNA was isolated from tissues using an RNeasy Mini Kit (Qiagen) or from serum or vaginal washes using a Viral RNA Isolation Kit (Qiagen). qRT-PCR was performed using a qScript One-Step qRT-PCR Kit (Quanta, Bioscience) with a CFX96 Touch™ real-time PCR detection system (Bio-Rad CFX Manager 3.1). ZIKV-specific primers have been previously described [55 (link)]. Cycling conditions were: 45°C for 15 min, 95°C for 15 min, followed by 50 cycles of 95°C for 15 s and 60°C for 15 s, and a final extension of 72°C for 30 min. Viral RNA concentration was calculated using a standard curve composed of five 100-fold serial dilutions of in vitro-transcribed RNA from ZIKV strain FSS13025.