Si nlrp3

The miR‐302c‐3p mimic, miR‐302c‐3p inhibitor and small‐interfering RNAs targeting NLRP3 (si‐NLRP3) were synthesized by GenePharma (Shanghai, China). HUVECs were transfected using the transfection reagent Lipofectamine 3000 (Invitrogen), according to the manufacturer's protocol for 24 h when cells reached 80% confluence. After that, the medium was renewed and cells were treated with or without ox‐LDL. HUVECs were classified into the miR‐302c‐3p mimic group, miR‐302c‐3p inhibitor group, negative control (NC) group, inhibitor NC (in‐NC) group, si‐NLRP3 group and si‐NC group. The sequences required for transfection are listed in Table S1.

The miRNAs agomiRs and antagomirs were purchased from GenePharma Company (Shanghai, China). BEND or 293T cells were transfected with 50 nM miRNA agomiRs or 100 nM antagomirs in 6-well plates with Lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions. siRNAs (the sequences are shown in Supplementary Table 3) for NLRP3 (si-NLRP3) and the negative control (si-NC) were designed and synthesized by GenePharma Co. (Shanghai, China). The siRNAs were transfected into BEND cells at a final concentration of 100 nM using Lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions.

Small interfering RNAs (siRNAs) against BTF3 (siBTF3#1: GCCGAAGAAGCCUGGGAAUCA; siBTF3#2: GCAGGCACAAGUGCGCAUUTT), STAT3 (siSTAT3#1: GUUGAAUUAUCAGCUUAAA; siSTAT3#2: CAUCUGCCUAGAUCGGCUA), NLRP3 (siNLRP3: CAACAGGAGAGACCUUUAU) and small interfering negative control (siNC) were constructed by GenePharma Technologies. Smart silencer of LINC01128 was purchased from RIBOBIO, and the overexpression (OE) plasmid of LINC01128 (OE‐LINC01128) was purchased from GeneKai. Cells were transfected at 50% confluency using jetPRIME in vitro siRNA transfection reagent (#114‐01, Polyplus).
ARID5B shRNA (shARID5B#1: GCCTTCAAAGAGAACCATTTA; shARID5B#2: CTACACCTGTAGGAAGTTCAT), scrambled negative control (shNC), OE‐ARID5B, OE‐STAT3 and negative control (OE‐NC) lentiviruses were constructed by GeneKai. After infecting with lentiviruses, cells were selected using puromycin (3 μg/mL). For co‐transfection, transfecting THP‐1 cells with the LINC01128 overexpression plasmid for 24 h, then performing a 48 h of infection with ARID5B shRNA or BTF3 siRNA.