Power sybr green pcr master mix

Total RNA was extracted from tumors using an RNA Isolation kit (CWbiotech Co., Ltd., Beijing, China) following the manufacturer's protocol. Stem-loop RT-qPCR for mature miR-21 was performed as previously described (28 (link)). RT-qPCR for PDCD4 was performed using Power SYBR^® Green PCR Master mix (Agilent Technologies, Inc., Santa Clara, CA, USA) in a final volume of 20 µl, comprising of 100 ng cDNA, 10 µl master mix, 1 µl ROX and 0.4 pmol/µl of each primer. qPCR cycling conditions were as follows: 95°C for 2 min, and then 95°C for 15 sec and 55°C for 30 sec, for 40 cycles, followed by 60°C for 1 min. The melting curve was 65–95°C. Human U6 mRNA was used for normalization for the stem-loop RT-qPCR and GAPDH was used for normalization for the PDCD4 RT-qPCR. Fluorescent signals were normalized to these internal reference genes, and the threshold cycle (Cq) was set within the exponential phase of the PCR. The relative gene expression was calculated by comparing cycle times for each target PCR. The target PCR Cq values were normalized by subtracting the U6 or GADPH Cq value, which provided the ΔCq value. The relative expression level between treatments was then calculated using the following equation: Relative gene expression=2^{(ΔCqsample−ΔCqcontrol)} (30 (link)).

Cell lysis, cDNA synthesis and real-time PCR were performed using the Power SYBR Green Cells-to-Ct Kit (Ambion/Thermo Fisher Scientific) according to the manufacturer’s protocol. Briefly, treated and untreated smooth muscle cells were directly lysed for 5 min at room temperature with Lysis Solution (provided in the kit) in 96-well culture plates after washing with phosphate-buffered saline (PBS). Cell lysates were reverse transcribed to synthesize cDNA using the RT Enzyme Mix and SYBR RT Buffer. Then cDNA was amplified by real-time PCR on the Stratagene Mx3005P System (Agilent Technologies) using Power SYBR Green PCR Master Mix and the specific primers as follows: MMP-2 forward primer 5′ ATGAATACTGGATCTACTCAGC 3′ and reverse primer 5′ GTATCTCCAGAATTTGTCTCC 3′, TIMP-1 forward primer 5′ CACCTTATACCAGCGTTATG 3′ and reverse primer 5′ TTTCCAGCAATGAGAAACTC 3′, COX-2 forward primer 5′ TGGAATTACCCAGTTTGTTG 3′ and reverse primer 5′ TGCGGTACTCATTAAAAGAC 3′, GAPDH forward primer 5′ CTTTTGCGTCGCCAG 3′ and reverse primer 5′ TTGATGGCAACAATATCCAC 3′ (Sigma-Aldrich). The amount of target mRNA was normalized to GAPDH, and the relative gene expression was calculated by the formula 2^–ΔΔCt using samples from the control group as calibrator samples [13 , 14 (link)].