The androgen responsive prostate cancer cell line, LNCaP and androgen insensitive prostate cancer cell line PC3 (both from the American Type Culture Collection, Manassas, VA) were grown in RPMI 1640 supplemented with 10% heat-inactivated fetal bovine serum and 100 IU/ml penicillin (Invitrogen Corp, Carlsbad, CA). The MAOA specific inhibitor, N-Methyl-N-propargyl-3-(2,4-dichlorophenoxy) propylamine hydrochloride (clorgyline), was purchased from Sigma-Aldrich (St Louis, MO). Docetaxel (provided by Sanofi-Aventis, Bridgewater, NJ) was diluted in 70% ethanol and used at 1 nM, 10 nM, and 100 nM concentrations for LNCaP cells and 50 nM and 200 nM for PC3 cells. For HIF1a expression studies, VCaP cells were grown in DMEM-F12 with 10% FBS. The MAOA specific inhibitor clorgyline (Sigma-Aldrich, St Louis, MO) was diluted in 70% ethanol and used at 1 µM concentration. Total RNA was isolated using the RNeasy kit (Qiagen, Valencia, CA). cDNA was synthesized using the SuperScript II Reverse Transcriptase kit (Invitrogen Corp, Carlsbad, CA). qRT-PCR reactions were done in triplicate, using SYBR Green master mix (Applied Biosystems, Foster City, CA) and analyzed using an Applied Biosystems 7700 sequence detector. Samples were normalized to the expression level of GAPDH.
7700 sequence detector
Manufactured by Thermo Fisher Scientific
Sourced in United States
The 7700 Sequence Detector is a real-time PCR instrument designed for quantitative gene expression analysis. It features a compact design, flexible configuration, and high-performance detection capabilities.
Automatically generated - may contain errors
Lab products found in correlation
Rneasy mini kit, by Qiagen (8 mentions)
Platinum sybr green pcr mix, by Thermo Fisher Scientific (7 mentions)
Sequence detection systems software, by Thermo Fisher Scientific (4 mentions)
Quantitect reverse transcription kit, by Qiagen (4 mentions)
Rneasy kit, by Qiagen (3 mentions)
Primescript rt reagent kit, by Takara Bio (3 mentions)
Taqman reverse transcription kit, by Thermo Fisher Scientific (3 mentions)
Trizol reagent, by Thermo Fisher Scientific (3 mentions)
Sequences detection systems software, by Thermo Fisher Scientific (2 mentions)
Taqman universal pcr master mix kit, by Thermo Fisher Scientific (2 mentions)
Sybr green pcr master mix, by Thermo Fisher Scientific (2 mentions)
Taqman universal pcr master mix reagent, by Thermo Fisher Scientific (2 mentions)
Rneasy micro kit, by Qiagen (2 mentions)
Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (2 mentions)
Quantitect primer assay, by Qiagen (2 mentions)
Clorgyline, by Merck Group (1 mentions)
Penicillin, by Thermo Fisher Scientific (1 mentions)
Rpmi 1640, by Thermo Fisher Scientific (1 mentions)
Sybr green master mix, by Thermo Fisher Scientific (1 mentions)
Superscript 2 reverse transcriptase kit, by Thermo Fisher Scientific (1 mentions)
22 protocols using 7700 sequence detector
1
Prostate Cancer Cell Response to Docetaxel and MAOA Inhibition
2
Quantitative Real-Time PCR Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from rat liver or cultured cells was extracted using the RNeasy Mini kit (Qiagen, Hilden, Germany), and 1 μg total RNA was reverse-transcribed into cDNA using PrimeScript™ RT reagent kit (Takara Bio, Kusatsu, Japan). Polymerase chain reaction (PCR) amplification was performed using a 25 μL reaction mixture that contained 1 μL cDNA and 12.5 μL Platinum SYBR Green PCR mix (Invitrogen, Carlsbad, CA, USA). β-Actin and cytoplasmic 18S small subunit ribosomal RNA (rRNA) messenger RNA that were amplified from the same samples served as internal controls. After initial denaturation at 95°C for 2 minutes, a two-step cycle protocol was used: denaturation at 95°C for 15 seconds and annealing and extension at 60°C for 1 minute, for 40 cycles in a 7700 Sequence Detector (Applied Biosystems, Foster City, CA, USA). Gene expression levels were determined using the comparative threshold cycle (ΔΔCt) method with β-actin and 18S rRNA used as endogenous controls. Data were analyzed with the Sequence Detection Systems software (Applied Biosystems). Primer sequences are shown in Table 1 .
3
Quantitative Analysis of mRNA Expression
4
Quantification of Plasma cfEBV DNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Peripheral blood (3.0 mL) was collected from each patient at the following timepoints: within 2 weeks before treatment initiation; 17~21 days after NAC completion and before the initiation of CRT, within 3 months after CRT completion. Plasma cfEBV DNA was quantified with RT-qPCR targeting the BamHI W fragment of the EBV genome as described by Lo et al. [45 (link)]. The sequences of the forward and reverse primers were CCCAACACTCCACCACACC and TCTTAGGAGCTGTCCGAGGG, respectively. A dual fluorescently labelled oligomer, 5′-(FAM) CACACACTACACACACCCACCCGTCTC (TAMRA)-3′ served as the probe. Amplifications were performed in an Applied Biosystems 7700 Sequence Detector and analyzed using Sequence Detection System software (version 1.6.3) developed by Applied Biosystems. The plasma EBV DNA concentration was calculated as previously described [45 (link)]. All samples were analyzed in duplicate and were re-tested a third time if the first two tests yielded varying results. The operators who measured the ctDNA were blinded to the patient information and clinical outcomes.
5
Quantitative Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA of the cultured cells or the rat colon was extracted using the RNeasy Mini Kit (Qiagen, Hilden, Germany), and 1 μg of the total RNA was reverse transcribed into cDNA using the PrimeScript™ RT reagent Kit (Takara Bio, Kusatsu, Japan). PCR was performed using a 25 μl reaction mixture containing 1 μl of cDNA and 12.5 μl Platinum SYBR Green PCR Mix (Life Technologies). β-actin messenger RNA amplified from the same samples served as an internal control. After initial denaturation at 95°C for 2 min, we used a 2-step cycle procedure (denaturation at 95°C for 15 s, annealing and extension at 60°C for 1 min) for 40 cycles in a 7700 Sequence Detector (Applied Biosystems, Foster City, CA, USA). Gene expression levels were determined using the comparative threshold cycle (ΔΔCt) method with β-actin used as an endogenous control. Data were analyzed with Sequences Detection Systems software (Applied Biosystems). The primer sequences are shown in Table 3
6
Quantifying Gene Expression in Human Skin
7
RNA Extraction and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from the liver samples using RNeasy columns (Qiagen, Valencia, Ca) according to manufacturer's protocol. RNA samples were analyzed by fluorescence-based quantitative real-time polymerase chain reaction (qRT–PCR) using an Applied Biosystems 7700 sequence detector. Target RNA levels were normalized to the total RNA concentration determined using ribogreen. Primers and probes for analysis of the expression of different genes were designed using Primer Express Software (Applied Biosciences, Carlsbad, CA, USA) (Supplementary Table S1). For the analysis, 100 ng of total RNA was used.
8
qRT-PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
cDNA was synthesized from 1 µg amplified RNA (aRNA) from paired pre- vs. post-treated patient samples, or 1 µg RNA extracted from cultured cells, using 2 µg random hexamers for priming reverse transcription by SuperScript II (200 U per reaction; Invitrogen). Quantitative reverse transcription real-time PCR (qRT-PCR) reactions were done in duplicate, using approximately 5 ng of cDNA, 0.2 µM of each primer, and SYBR Green PCR master mix (Applied Biosystems, Foster City, CA) in a 20 µl reaction volume and analyzed using an Applied Biosystems 7700 sequence detector. Samples were normalized to the cycle threshold value obtained during the exponential amplification of GAPDH. Control reactions with RNA or water as template did not produce significant amplification products. The sequences of primers used in this study were: GAPDH forward, 5′-CCTCAACGACCACTTTGTCA-3′ ; GAPDH reverse, 5′-TTACTCCTTGGAGGCCATGT-3′ ; MAOA forward, 5′-AAAGTGGAGCGGCTACATGG-3′ ; MAOA reverse, 5′-CAGAAACAGAGGGCAGGTTCC-3′ ; pleiotrophin (PTN) forward: 5′-GGGCAGCAATTTAAATGTTATGACTA-3′ ; PTN reverse: 5′-ACCCCCATTTTGCTGACTACATT-3′ .
9
Quantitative Gene Expression Analysis
10
Quantitative PCR Analysis of SDF-1 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using TRizol reagent (Invitrogen, Carlsbad, CA), or RNeasy micro kit (Qiagen, Gaithersburg, MD, USA). cDNA for PCR templates was prepared by reverse transcription of total RNA (100 ng) using Taqman Reverse Transcription kit (Applied Biosystems, Carlsbad, CA, USA). Real-time PCR was performed on a 7700 Sequence Detector (Applied Biosystems, Carlsbad, CA, USA) using Taqman Universal PCR Master Mix Reagents (Applied Biosystems, Carlsbad, CA, USA). SDF-1 real-time PCR primers were designed and purchased from Sigma: sense primer 5′-AGC-CAA-CGT-CAA-GCA-TCT-CAA-3′; antisense primer 5′-AAT-CCA-CTT-TAG-CTT-CGG-GTC-AA-3′. 36B4 primer sequences have been described previously (Quan et al., 2001 (link)). The target gene expression levels were determined by relative quantification using the comparative CT method, also known as 2-∆∆CT method (comparative 2–[delta][delta]Ct method). Target gene mRNA expression levels were normalized to the housekeeping gene 36B4 (internal control for quantification), and expressed as a fold change of 36B4.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!