Trizol reagent

Total RNA was extracted from MDSCs-derived IPCs at five stages using TRIZOL reagent (AidLab, China). A miRNA library was constructed using the Illumina TruSeq Small RNA kit (Illumina, CA, USA), and miRNA-seq was performed on the Illumina Hiseq 2500 platform. The read quality was evaluated using the online tool FastQC v0.11.9 (https://www.bioinformatics.babraham.ac.uk/projects/fastqc/). The high-quality sequencing data (clean reads) were screened according to the criteria as follows: 1) Remove the 3’ linker sequence in the reads, and remove the reads without insert fragments due to the self-ligation of the linker; 2) Remove the reads with low sequencing quality in 3’-base (the quality value is less than 20); 3) Remove reads containing unknown base N; 4) Choose reads with length between 18nt and 32nt. These analysis parameters have been added to the Methods section. The obtained clean reads were applied for DEmiRNAs identification using DESeq2 (v1.34.0) [16 (link)], DEGseq (v1.48.0) [17 (link)] and edgeR (v3.36.0) [18 (link)] in Bioconductor. miRanda (v3.3a), TargetScan (http://www.targetscan.org/vert_72/), and RNAhybrid [19 (link)] were employed to determine target genes of DEmiRNAs. For functional enrichment analyses, the target genes of DEmiRNAs were annotated through Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analyses.

Total RNA was isolated from MDSCs-derived IPCs using TRIZOL reagent (AidLab, China), and reverse transcription reaction was conducted using a FastKing OneStep Probe RT-qPCR MasterMix (TIANGEN, China). qRT‑PCR was performed in Mx3000P Real-Time PCR System (Stratagene, CA, USA) under the following reaction program: 95°C for 3 min, 40 cycles of 95°C for 12 s and 62°C for 40 s. The relative mRNA expression level of miRNA and IPCs-related genes were calculated using the -2^ΔΔCt method. U6 was used as a reference gene for miRNA and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) for IPCs-related genes. The primers used in this study are listed in Table 1.

Total RNA was extracted by Trizol reagent (Aidlab) according to the manufacturer’s instructions. cDNA samples were reverse transcribed from total RNA of glioma surgical specimens and glioblastoma cell lines. The amplification program used was as follows: 50 °C for 2 min, 95 °C for 10 min, followed by 40 cycles at 95 °C for 30 s and 60 °C for 30 s. The relative expression of CBX3 was determined by the 2^−ΔΔCt method with GAPDH as an internal control. The primer sequences are listed in Additional file 1: Table S2.

Total RNA of hepatopancreas tissues was extracted by TRIzol reagent (Aidlab, Beijing, China), following the manufacturer’s instructions. The concentration and quality of RNA were detected by a NanoDrop-2000C (Thermo Scientific, Wilmington, NC, USA) and 1% agarose gel electrophoresis, respectively. Total RNA first-strand cDNA of each sample was generated using the PrimeScript™ RT Master Mix Real Time Kit (Takara, Japan). The transcribed cDNA was stored at −20 °C for subsequent experiments. The fluorescent quantification dye was TransStart Top Green qPCR SuperMix (TransGen, Beijing, China). Primer sequences for anti-stress genes are shown in Table S1. 18S rRNA was used as an internal reference gene, and the 2^−ΔΔct method was used for calculation [31 (link)].

Total RNA was extracted from human NP tissue using TRIzol reagent (Aidlab, Beijing, China) according to the manufacturer’s instructions. An ultraviolet spectrophotometer (Shunyu, Shanghai, China) was used to measure RNA purity and concentration. A 7500 real-time PCR instrument (Applied Biosystems, Foster City, CA, USA) was used to quantify miR-129-5P and Beclin-1 and LC3 mRNA levels. The primers used for qRT-PCR are listed in Table 2. U6 was used as the endogenous control. The fold-change in gene expression relative to the control was calculated with the 2^−ΔΔCt method.

The plated MC3T3-E1 cells were collected at day 14 and were preserved in RNAlater (Genecopoeia). All cells were then pulverized, and total RNA was extracted using TRIzol reagent (Aidlab, China) following the instructions provided. RNA was used to synthesize first-strand cDNA by reverse transcriptase (Genecopoeia). For the polymerase chain reaction (PRC), aliquots of synthesized cDNA were added to PCR mixtures containing Taq polymerase (TAKARA, Japan) and cycled on a DNA thermal cycler. PCR primers were as follows: (1) collagen type I (Col-I) fwd 50 GGCAAAGATGGAGAAGCTGG 30, COL I rev 50 GGAAACCTCTCTCGCCTCTT 30; (2) osteocalcin (OCN) fwd 50 GGACCATCTTTCTGCTCACTC 30, OCN rev 50 CTGCTTGGACATGAAGGCTT 30; and (3) osteopontin (OPN) fwd 50 TCACTCCAATCGTCCCTACA 30, OPN rev 50 GACTCCTTAGACTCACCGCT 30. PCR products were then determined after calculating the optimal annealing temperature for each primer pair by using densitometry and OLIGO Primer Analysis Software.

To determine the expression levels of GhSOS1 in cotton seedlings treated with various abiotic stresses and analyze the expression of GhSOS1 and the salt-related genes in the transgenic Arabidopsis plants, total RNA from cotton seedlings and Arabidopsis plants was respectively isolated from the collected tissues using TRIzol reagent (Aidlab Biotech). The amplification of quantitative real-time PCR products was performed in a reaction mixture of 20 μL of SYBR Green Master Mix (Transgen Biotech) according to the manufacturer’s instructions. Three biological replicates and three technical replicates for each sample were performed. The primers used for quantitative real-time PCR are shown in S1 Table.