Anti-Argonaute 2 (AGO2) (cat. no. C34C6, Cell Signaling Technology, Inc.) and anti-IgG antibodies (cat. no. 8726S Cell Signaling Technology, Inc.) were incubated with protein A+G beads at 4°C for 1 h following the instructions provided with the RNA Immunoprecipitation kit (cat. no. P0101, Geneseed Biotech Co., Ltd.). Briefly, 1 ml Buffer A working solution contained 1% volume protease inhibitor and 1% volume RNase inhibitor before use. A total of 1×107 GC-MSCs cells were used for each IP reaction and added 1 ml of the configured RIP lysis buffer. The lysate was centrifuged at 14,000 × g for 10 min, at 4°C. The resulting supernatant and antibody-attached magnetic beads were incubated for 1 h at 4°C. The product was obtained by centrifugation at 12,000 × g for 1 min at 4°C. The captured RNAs and target protein were finally eluted and purified for RT-qPCR and western blot analyses.
Anti igg antibodies
Manufactured by Cell Signaling Technology
Sourced in United States
Anti-IgG antibodies are proteins that specifically bind to immunoglobulin G (IgG) molecules. These antibodies can be used in various laboratory applications to detect and quantify IgG proteins in a sample.
Automatically generated - may contain errors
Lab products found in correlation
Lightcycler 480 sybr green 1 master mix, by Roche (1 mentions)
Anti rna polymerase 2, by Merck Group (1 mentions)
C digit blot scanner system, by LI COR (1 mentions)
Smad4 antibody, by Cell Signaling Technology (1 mentions)
Dna purification kit, by Beyotime (1 mentions)
Smad4, by Cell Signaling Technology (1 mentions)
Chip assay kit, by Beyotime (1 mentions)
Anti elavl1, by Cell Signaling Technology (1 mentions)
Magna rip rna binding protein immunoprecipitation kit, by Merck Group (1 mentions)
5 protocols using anti igg antibodies
1
RNA Immunoprecipitation of AGO2 in GC-MSCs
2
ChIP Assay for A20 Gene Regulation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
SK-N-AS cells (3 × 106) were plated in 10-cm2 dishes and incubated at 37 °C for 48 h. Dishes were incubated at the appropriate temperature 1 h before treatment with 10 ng TNFα. ChIP assays were performed as described previously (3 (link)) based on the protocol by Upstate Biotechnology. Immunoprecipitation was carried out using 5 μg of either Anti-RNA polymerase II (Merck 05-623) or Anti-IgG antibodies (Cell Signaling #2729s). DNA was extracted and amplified by PCR as described previously (3 (link)). The following primer sequences were used: A20 gene forward GGTGTTGGAGAGCACAATGG, reverse CAGTGTGTATCGGTGCATGG, amplifying 160 bp of DNA. The qPCR was performed using LightCycler 480 SYBR Green 1 Master Mix (Roche).
3
Orexin A Modulation of BMP-4 Signaling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PC12 cells (3 × 105 cells/mL) were pretreated with orexin A (300 nM) in DMEM containing no serum and 1% PS for 48 h. After a 1 h stimulation with BMP-4 (3 ng/mL), the cells were solubilized via a sonicator in a 100 μL RIPA lysis buffer (Upstate Biotechnology, Lake Placid, NY, USA) containing 1 mM of Na3VO4, 1 mM of NaF, 2% SDS and 4% β-mercaptoethanol as reported previously [19 (link)]. The samples were then subjected to SDS-PAGE/immunoblotting analysis with primary antibodies, anti-phospho-Smad1/5/9 (pSmad1/5/9) antibodies (13,820, Cell Signaling Technology, Inc., Beverly, MA, USA) and anti-total-Smad1 (tSmad1) antibodies (9743, Cell Signaling Technology, Inc.), at 1:500 dilution and then with anti-IgG antibodies (7074, Cell Signaling Technology, Inc.) at 1:104 dilution. The integrated band intensities were measured using the C-DiGit® Blot Scanner System (LI-COR Biosciences, Lincoln, NE, USA). Phospho-Smad1/5/9 levels were evaluated using the ratios of the signal intensities of phospho-Smad1/5/9/total-Smad1.
4
ChIP Assay for Transcription Factor Binding
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ChIP was executed with the ChIP assay kit (Beyotime) using the Smad 4 antibody, Smad 4, and anti-IgG antibodies (Cell Signaling Technology). The ChIP DNA was extracted with the DNA Purification Kit (Beyotime) and the samples were then subjected to qPCR amplification with primers spanning the protein-binding sites. The primers used were for miR-26a (F: 5′-GAGGCCTGATGGAGCCGTGGGGACC-3′, R: 5′-AGAG CCACAGCAGGCGGAAAGCCAGATGCCACAGG-3′), miR-375 (F: 5′-TTTCCTAGAACTGCTGTCTTGTCCCATCGCC CACA-3′, R: 5′-AAGAACCCACCCTTTCCTCATCAGAACCAC TTTGC-3′), and Ngn3 (F: 5′-TTAGGCTTTGGATTCTTCATAG TTCTGATAGGATTTGC-3′, R: 5′-AAGTGTCTTCTGGTCCC AGGAATGGAGGCGTAAGG-3′).
5
RIP Assay for ELAVL1 mRNA Targets
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RIP assays were performed by using the Magna RIP RNA-Binding Protein Immunoprecipitation Kit (Millipore, USA) according to the manufacturer’s instructions. Briefly, cells were lysed in lysis buffer and the cleared lysates were immunoprecipitated with the indicated anti-ELAVL1 and anti-IgG antibodies (Cell Signaling Technology). Immunoprecipitated and input RNA was isolated and reverse transcribed for qRT-PCR amplifications with PTEN 3′-UTR-specific primers. mRNA relative expression level was normalized to input mRNA expression. The primers used for amplification are listed in Supplementary Table 1 .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!