Total RNA was treated with DNase I (Roche) and reverse-transcribed using SuperScript Reverse Transcriptase III (Invitrogen) and random primers (Invitrogen). Real-time quantitative PCR (qPCR) was performed with 2x Sensimix SYBR mastermix (Bioline) and analyzed on a Corbett Research Rotor-Gene GG-3000 machine.
Sensimix sybr master mix
Manufactured by Meridian Bioscience
Sourced in United Kingdom
SensiMix SYBR master mix is a ready-to-use solution for real-time PCR amplification and detection. It contains all the necessary components, including DNA polymerase, dNTPs, and SYBR Green I fluorescent dye, to perform real-time PCR reactions.
Automatically generated - may contain errors
Lab products found in correlation
Lightcycler 480, by Roche (5 mentions)
Nanodrop spectrophotometer, by Thermo Fisher Scientific (4 mentions)
Superscript 3 reverse transcriptase, by Thermo Fisher Scientific (3 mentions)
High capacity rna to cdna master mix, by Thermo Fisher Scientific (3 mentions)
Rneasy rna purification kit, by Qiagen (3 mentions)
Rneasy mini kit, by Qiagen (3 mentions)
Random primer, by Thermo Fisher Scientific (2 mentions)
Rotor gene gg 3000 machine, by Qiagen (2 mentions)
Dnase 1, by Roche (2 mentions)
Trizol reagent kit, by Thermo Fisher Scientific (2 mentions)
High capacity rna to cdna kit, by Thermo Fisher Scientific (2 mentions)
On column dnase digestion, by Qiagen (2 mentions)
Qscript cdna synthesis kit, by Quanta Biosciences (1 mentions)
Rnase free dnase treatment, by Qiagen (1 mentions)
Trizol, by Thermo Fisher Scientific (1 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (1 mentions)
Precisionplus mastermix, by Primerdesign (1 mentions)
Genelute pcr clean up kit, by Merck Group (1 mentions)
Mxpro 3000, by Agilent Technologies (1 mentions)
13 protocols using sensimix sybr master mix
1
RNA Extraction and Real-time qPCR
2
RNA Extraction and Real-time qPCR
3
Quantitative Analysis of Thyroid Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from slices using a Qiagen RNeasy RNA purification kit. cDNA was synthesized from 500 ng total RNA using High Capacity RNA‐to‐cDNA Master Mix (Applied Biosystems Ltd). Dio2 and Dio3 primers were obtained from Qiagen (QuantiTect Primer Assays Rn_Dio2_2_SG and Rn_Dio3_1_SG, respectively); other primers (Table 1 ) were designed using PrimerBLAST (Ye et al., 2012 ). qPCR reactions were set up using SensiMix SYBR master mix (Bioline) and were run on a Roche LightCycler 480 and analysed using LightCycler 480 1.5 software. Expression of genes of interest was normalized to Actb levels. Standard curves and blank controls were run for all sets of primers. Results shown are from a minimum of two independent experiments per condition. Gene expression in T3‐injected rats was compared to that of vehicle‐injected controls using unpaired Student's t‐tests. Expression in treated hypothalamic slices was compared to control slices from the same individuals by paired Student's t‐tests or ANOVA.
4
Quantifying Retinoic Acid-Induced Rarres2 in Hypothalamic Slices
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Ex-vivo hypothalamic slice cultures were set up as previously described9 (link). Slices were treated for 48 hrs with 1 μM RA or an equivalent concentration of DMSO (0.1%) diluted in culture medium. Following treatment, total RNA was extracted from slices using a Qiagen RNeasy RNA purification kit. cDNA was synthesized from 500 ng total RNA using a High Capacity RNA-to-cDNA Master Mix (Applied Biosystems). qPCR reactions were set up using SensiMix SYBR master mix (Bioline) and run on a Roche LightCycler 480. Primer sequences for Rarres2 were F-CGGACATACACGGGACAGAGCTTGA and R-CAGCTGAGAAGAACAGGTCATCAGCAC and for Actb were F-CCACACCCGCCACCAGTTCG and R-TACAGCCCGGGGAGCATCGT. Rarres2 expression was normalised to Actb levels. Standard curves and blank controls were run for both sets of primers.
5
Mapping STAT3 Binding in HPV18-Positive Keratinocytes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ChIP experiments were carried out in primary foreskin keratinocytes containing episomal HPV18 genomes as previously described [60 (link)]. ChIP efficiency throughout the HPV18 genome was assessed by quantitative PCR (qPCR) using SensiMix SYBR master mix (Bioline). Primer sequences are available on request. STAT3 association with the cyclin D1 promoter was assessed in each individual ChIP experiment using previously described primer sequences [87 (link)].
6
Quantitative Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The Trizol reagent kit (Invitrogen, UK) was used to isolate the total RNA. First strand cDNA synthesis was done at 42°C for 50 min using SuperScript III reverse transcriptase and random hexamers, according to the manufacturer's instructions (Invitrogen, UK). cDNA (15 ng) was amplified in a 20 μL reaction volume containing 1X SensiMix SYBR Master mix (Bioline, UK) and 3 pmol of each primer (Table S2 ). The transcription level of specific genes was normalized to gyrB transcription, which was amplified in parallel with SPD0709F and SP0709R primers. The results were analyzed by the comparative CT method (Livak and Schmittgen, 2001 (link)).
7
Quantitative PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using an RNeasy mini kit (Qiagen) with on-column DNase digestion (Qiagen) to remove genomic DNA. RNA was quantified using a NanoDrop spectrophotometer (Thermo Scientific) and precipitated in 100% ethanol, linear acrylamide and ammonium acetate. cDNA was synthesised from 150–200 ng (mouse), 500 ng (rat and human), or 250 ng (SH-SY5Y cells) total RNA using a High Capacity RNA-to-cDNA kit (Applied Biosystems). qPCR analysis was performed using SensiMix SYBR mastermix (Bioline) using primers designed for mouse (Table 1 (A)), human (Table 1 (B)), or rat (Table 1 (C)) with an annealing temperature of 60 °C for 45 cycles. Samples were run on a LightCycler 480 (Roche) and data were analysed using LightCycler 480 Software 1.5. Target gene expression was normalised to Actb (mouse) or Gapdh (rat and SH-SY5Y) expression.
8
Total RNA Isolation and Quantitative RT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Trizol reagent kit (Invitrogen, UK) was used to isolate the total RNA [65 (link)]. SuperScript III reverse transcriptase (Invitrogen, UK) was used to synthesise first strand cDNA using random hexamers at 42°C for 50 min according to the manufacturer’s instructions. cDNA (15 ng) was amplified in a 20 μl reaction volume that contained 1X SensiMix SYBR Master mix (Bioline, UK) and 3 pmol of each primer (S2 Table
9
Quantitative RT-PCR of Adrenal Tissue
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using an RNeasy mini kit (Qiagen) with on-column RNase-Free DNase treatment (Qiagen). Complementary DNA (cDNA) was synthesized from 500 ng total RNA using a qScript™ cDNA Synthesis Kit (CAT# 95047-100, Quanta Biosciences™). As yields from the cultured adrenal tissue were low, RNA was concentrated by ethanol precipitation before cDNA synthesis. Quantitative real-time PCR (qRT-PCR) was performed using the SensiMix SYBR master mix (Bioline) on a Roche LightCycler 480. The primers used for qPCR are listed in Table 1 . Primers were designed using Primer-BLAST1 and synthesized by PrimerDesign Ltd or Sigma-Aldrich. Actb was used as the reference gene for all samples. All samples were run in triplicate, along with standard curves prepared from a 5-fold dilution of the stock cDNA samples mixed together and blanks. qPCR analysis was performed using relative quantification on Roche LightCycler 480 Software 1.5.1.
10
Quantitative Real-Time PCR Analysis of Cytokine Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from tissues or cells using Trizol (Invitrogen). cDNA was generated from 2 μg RNA using MMLV Reverse Transcriptase (Bioscript Bioline) and real-time PCR analyses were performed with SensiMix SYBR Master mix (Bioline) using an Applied Biosystems StepOnePlus™ Real-Time PCR System according to the manufacturer’s instructions. The abundance of each mRNA was normalized relative to PCR of the housekeeping gene Hypoxanthine-guanine phosphoribosyltransferase (Hprt). Mouse Il1β, forward, CGGCACACCCACCCTG, and reverse, AAACCGTTTTTCCATCTTCTTCT; mouse Il6, forward, ACAACCACGGCCTTCCCTAC, and reverse, TCCACGATTTCCCAGAGAACA; The abundance of each mRNA was normalized relative to PCR of the housekeeping gene Hprt with the following primers: forward, GTCCCAGCGTCGTGATTAGC, and reverse, TGGCCTCCCATCTCCTTCA.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!