Qscript xlt cdna supermix kit

Manufactured by Quanta Biosciences

The QScript XLT cDNA SuperMix kit is a reagent used for reverse transcription and cDNA synthesis. It contains a blend of reverse transcriptase, RNase inhibitor, and other necessary components for producing cDNA from RNA templates.

Automatically generated - may contain errors

Lab products found in correlation

Rneasy mini kit, by Qiagen (3 mentions) Faststart universal probe master kit, by Roche (3 mentions) Taqman probes for qpcr, by Thermo Fisher Scientific (3 mentions) Trizol, by Thermo Fisher Scientific (3 mentions) Powerup sybr green master mix, by Thermo Fisher Scientific (3 mentions) Maxima first strand cdna synthesis kit, by Thermo Fisher Scientific (2 mentions) Gotaq flexi buffer, by Promega (1 mentions) Rnaeasy mini kit, by Qiagen (1 mentions) Nucleospin rna 2, by Macherey-Nagel (1 mentions) Gotaq flexi, by Promega (1 mentions)

Close spelling variants of this product

QScript XLT cDNA SuperMix QScript cDNA Supermix kit QScript cDNA SuperMix QScript cDNA kit QScript Supermix QScript kit

8 protocols using qscript xlt cdna supermix kit

Quantifying Relative mthl8 Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Relative transcript levels of mthl8 were assessed in the indicated genotypes using RT-PCR. Total RNA was collected from three wandering L3 larvae in triplicate using the RNeasy Mini Kit (Qiagen). Synthesis of cDNA from 1000 ng RNA was performed using the qScript XLT cDNA SuperMix kit (Quanta Biosciences). For the PCR reactions, RNA was diluted 1:10, Promega GoTaq Flexi buffer and polymerase with the following primers were added:

mthl8 forward 5′-CCGCTGCTCCATGGGAAC, reverse 5′-GCCGCATTTGAGAGATTTGC

rp49 forward 5′-GCCCAAGGGTATCGACAACA, reverse 5′-GCGCTTGTTCGATCCGTAAC;

Brooks D., Bawa S., Bontrager A., Stetsiv M., Guo Y, & Geisbrecht E.R. (2022). Independent pathways control muscle tissue size and sarcomere remodeling. Developmental biology, 490, 1-12.

+ Open protocol

+ Expand

Quantitative PCR Analysis of Transcripts

Check if the same lab product or an alternative is used in the 5 most similar protocols

Transcript levels were assessed using quantitative PCR (qPCR). Total RNA was collected from three wandering L3 larvae in triplicate using the RNeasy Mini Kit (Qiagen, Hilden, Germany). Synthesis of cDNA from 150 ng RNA (NUAK and stv RNAi) or 300 ng RNA (Hsc70-4 and Atg8a RNAi)was performed using the qScript XLT cDNA SuperMix kit (Quanta Biosciences, Beverly, MA). Dilutions of cDNA were optimized according to each primer set (1:10 to 1:100) and combined with PowerUp SYBR Green Master Mix (ThermoFisher, Waltham, MA). The following primers were used: rp49 forward 5’-GCCCAAGGGTATCGACAACA, reverse 5’-GCGCTTGTTCGATCCGTAAC; NUAK forward 5-CAGTTCCAACACAACCACGC, reverse 5’-GGATGATAAACTCCCGCGGA; stv forward 5’-GTTCCTCCAAATCAGCAGCA, reverse 5’-CAAAGTGTGAGTCGCCGAAG; Hsc70-4 forward 5’-TGG GCA AGA CTG TGA CCA AC, reverse 5’- TCC AGA CCG TAA GCG ATA GCA; Atg8a forward 5’-GGATGCCCTCTTCTTCTTTGTG, reverse 3’-CGGAGTAGGCAATGTACAGGA; cher forward 5’-GCCCTTCCAGCCACTAATAGT, reverse 5’-GCTGCCCACCTTGCTCATAT; l(2)efl/CryAB forward 5’-TTCCACCCTCAACATCGACA, reverse 5’-CATGCTTTCCCTCCACGATG; ref(2)p/p62 forward 5’- GCCCTCCCAGAATTACACCA, reverse 5’- GTTGGCCGAAGAACCCTCT. All primers were synthesized at Integrated DNA Technologies (IDT, Stokie, IL). Quantitative transcript levels were obtained using the 2-ΔΔCt method and graphed as Mean +/- SEM using GraphPad 6.0.

Brooks D., Naeem F., Stetsiv M., Goetting S.C., Bawa S., Green N., Clark C., Bashirullah A, & Geisbrecht E.R. (2020). Drosophila NUAK functions with Starvin/BAG3 in autophagic protein turnover. PLoS Genetics, 16(4), e1008700.

+ Open protocol

+ Expand

Quantitative Real-Time PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from a pool of three wandering L3 larvae using the RNAeasy Mini Kit (QIAGEN) for each genotype. After elution, RNA concentrations were determined and single-strand complementary DNA (cDNA) was generated from 300 ng of RNA using the qScript XLT cDNA SuperMix kit (Quanta Biosciences). For the qPCR reactions, each cDNA sample was diluted to 1:50 and mixed with Power UP SYBR Green Master mix and the appropriate primers (Applied Biosystems). rp49 was used as the reference gene. The following primers were synthesized by Integrated DNA Technologies (IDT):

tn: 5′F-GAGCTGCATATCGAAATCACCG-3′; 5′R-AGATAGGCTTTTTCCGAGCAAAC-3′

rp49: 5′F-GCCCAAGGGTATCGACAACA-3′; 5R’-GCGCTTGTTCGATCCGTAAC-3′.

Three independent biological replicates were processed for each genotype and reactions were run in triplicate using the Quant Studio 3 Applied Biosystem with Quant studio design and analysis software. The average of the triplicates was used to calculate the 2^–ΔΔCt values (normalized fold expression).

Bawa S., Gameros S., Baumann K., Brooks D.S., Kollhoff J.A., Zolkiewski M., Re Cecconi A.D., Panini N., Russo M., Piccirillo R., Johnson D.K., Kashipathy M.M., Battaile K.P., Lovell S., Bouyain S.E., Kawakami J, & Geisbrecht E.R. (2021). Costameric integrin and sarcoglycan protein levels are altered in a Drosophila model for Limb-girdle muscular dystrophy type 2H. Molecular Biology of the Cell, 32(3), 260-273.

+ Open protocol

+ Expand

Quantifying MSCs Transcriptional Profiles

Check if the same lab product or an alternative is used in the 5 most similar protocols

For further analysis of the expression of MSCs transcripts, total RNA was extracted using NucleoSpin RNA II (Macherey‐Nagel, Düren, Germany) at days 7, 14, and 21. Reverse transcription was performed using 1 μg d'ARN with the Maxima First strand cDNA synthesis kit (Thermo Scientific). Quantitative PCR analysis was then performed with the qTower system (Analytik Jena, DE) and the sybr green technology using the qScript XLT cDNA superMix kit (Quanta Biosciences). Triplicate using 10 ng of cDNA was done for each sample. For each PCR, the specificity of the PCR product was verified using the melting curve. Gene names and primer sequences are in Supporting Information Table S3. Fold‐change was obtained using the 2^−ΔΔCt method.

Leveque X., Hochane M., Geraldo F., Dumont S., Gratas C., Oliver L., Gaignier C., Trichet V., Layrolle P., Heymann D., Herault O., Vallette F.M, & Olivier C. (2019). Low‐Dose Pesticide Mixture Induces Accelerated Mesenchymal Stem Cell Aging In Vitro. Stem Cells (Dayton, Ohio), 37(8), 1083-1094.

+ Open protocol

+ Expand

Multiomic Analysis of Airway Epithelial Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells were harvested using 0.05% Trypsin-EDTA (ThermoFisher, 25300054), pelleted at 300g for 5 min, suspended in 2% FBS DMEM with EDTA and filtered through a 40μm strainer before being analyzed by flow cytometry or cell sorting. RNA was extracted with Trizol (Invitrogen, 15596026). cDNA was synthesized from 1 ug of RNA with qScript XLT cDNA Super Mix kit (Quanta Biosciences, 95161–100). qPCR was carried out using FastStart Universal Probe Master kit (Roche, 04914058001) with 40 ng of cDNA per reaction. Taqman probes for qPCR (Applied Biosystems) are shown below:
FOXI1, Hs00201827_m1 FOXJ1, Hs00230964_m1; P63, Hs00978340_m1; GAPDH, Hs99999905_m1; CFTR, Hs00357011_m1; ATP6V1B1, Hs00266092_m1; ITGA6, Hs01041011_m1; DNAI2, Hs01001544_m1; SCGB1A1, Hs00171092; MUC5B, Hs00861588_m1; NRARP, Hs01104102_s1; HES5, Hs01387464_g1; HES1, Hs00172878_m1; MUC5AC, Hs01365601_m1

Plasschaert L.W., Žilionis R., Choo-Wing R., Savova V., Knehr J., Roma G., Klein A.M, & Jaffe A.B. (2018). A single cell atlas of the tracheal epithelium reveals the CFTR-rich pulmonary ionocyte. Nature, 560(7718), 377-381.

+ Open protocol

+ Expand

Quantifying Genetic Expression in Fixed Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA from fixed cells was extracted with RecoverALL Total Nuclei Acid Isolation kit (AM1975; Thermo Fisher Scientific). RNA from the nonfixed samples was extracted with Trizol (15596026; Invitrogen). cDNA was synthesized from 1 µg RNA with qScript XLT cDNA Super Mix kit (95161-100; Quanta Biosciences). qPCR was performed using FastStart Universal Probe Master kit (04914058001; Roche) with 40 ng cDNA per reaction. Taqman probes for qPCR (Applied Biosystems) are as follows: FOXA3, Hs00270130_m1; FOXJ1, Hs00230964_m1; P63, Hs00978340_m1; GAPDH, Hs99999905_m1; and TRRAP, Hs00268883_m1.

Wang Z., Plasschaert L.W., Aryal S., Renaud N.A., Yang Z., Choo-Wing R., Pessotti A.D., Kirkpatrick N.D., Cochran N.R., Carbone W., Maher R., Lindeman A., Russ C., Reece-Hoyes J., McAllister G., Hoffman G.R., Roma G, & Jaffe A.B. (2018). TRRAP is a central regulator of human multiciliated cell formation. The Journal of Cell Biology, 217(6), 1941-1955.

+ Open protocol

+ Expand

Multiomic Analysis of Airway Epithelial Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

+ Open protocol

+ Expand

Analysis of l(3)17289 Mutant Genotype

Check if the same lab product or an alternative is used in the 5 most similar protocols

Homozygous mutant l(3)17289 L3 individuals were washed with 0.7% NaCl/0.04% Triton X-100 and thoroughly rinsed with ultrapure water. After homogenization, total RNA was extracted and purified using the RNeasy mini kit (Qiagen, Germantown, MD). Synthesis of cDNA was performed using the qScript XLT cDNA SuperMix kit (Quanta Biosciences, Beverly, MA). RT-PCR was performed using Promega GoTaq Flexi (Madison, WI) with NUAK_seq_forward 5’-TCATCGAACCGCAAGCTAC and NUAK_seq_reverse 5’- GTCCTCCTCGTTGGAGCTTT. Sanger sequencing was performed by GeneWiz using the following primer: 5’- GCTGCAGAGGGACCTACG.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!