Chelex 100 resin

For the extraction of genomic DNA, five insects with symptoms of infection (found dead with open wings and deformed abdomen) were washed in 0.85% (w/v) NaCl sterile solution (Fig. 1). To extract genomic DNA from G. platensis, the abdomens of the five adults were macerated and added to a microtube with 160 µL of 10% Chelex solution (Sigma-Aldrich) and 8 µL of 20 mg/mL proteinase K. The samples were placed in a thermal block at 95 °C for 20 min, following a protocol for DNA extraction⁴⁵ , with Chelex 100 resin (Sigma-Aldrich). The DNA was eluted and stored at − 20 °C until use.

Stool samples from patients with diarrhea, and suspected of having CDI, were tested in the diagnostic laboratory for C. difficile using the GeneXpert C. difficile epi test following manufacturer’s instructions [3 (link), 17 ]. C. difficile cultures were performed in the research laboratory. Briefly, stool samples were mixed with an equal volume of 100 % ethyl alcohol for 60 min at room temperature. One hundred microliters of the mixture were spread on Clostridium difficile base agar plates (CDBA) (Oxoid, Inc), supplemented with 0.1 % taurocholate (Sigma), norfloxacin 12 mg/L, moxalactam 32 mg/L, Cystein-HCl 0.5 g/L and 7 % defibrinated horse blood and incubated at 36 ± 0.5 °C for 72 to 96 h under anaerobic conditions (90 N₂, 5 CO_2, and 5 H₂). Presumptive identification as C. difficile was based on colony size, morphology and fluorescence properties [18 (link)]. Isolated single C. difficile colonies were picked and inoculated into 0.5 mL of pre-reduced Chopped Meat Glucose Broth (CMGB) (Anaerobic Biosystems, USA) and incubated for 72 to 96 h under anaerobic conditions. Bacteria and spores were collected from the broth medium by centrifugation at 13,000xg for 5 min, and the DNA was extracted by boiling the sediment in 1 % Chelex-100 resin (Sigma, Inc) suspension for 20 min. Samples were centrifuged at 13000xg for 5 min, and the supernatant was used for downstream testing.

Mitochondrial DNA copy number (mtDNA-CN) was determined following a protocol adapted from Fazzini et al. and Singh et al. [39 (link),40 (link)]. Genomic DNA was extracted from snap-frozen liver pieces in 5% Chelex 100 resin (Sigma-Aldrich, St. Louis, MO, USA at 100 °C for 15 min under constant shaking at 500 rpm. After centrifugation at 12,000× g for 1.5 min the yield and purity of the DNA in the supernatant was quantified and a quantitative real-time PCR was performed using the following primer probe combinations: mitochondrial gene, mtRnr2 forward CCTGCCCAGTGACTAAAGTT, mtRnr2 reverse GACAGTTGGACCCTCGTTTAG, mtRnr2 probe ATCCTGACCGTGCAAAGGTAGCAT; nuclear gene, Gusβ forward GAGCTTTCGAAGCAGGAGTAG, Gusβ reverse CCAGGAGAGGTGAAGTGTTATG, Gusβ probe AGATGGACCACACTTCACAGGTCA. Real-time PCR reactions were performed on the CFX96 PCR System (Bio-Rad, Hercules, CA, USA). PCR efficiency was determined by 3-fold serial dilutions of the DNA; mtDNA copy number was calculated using the formula mtDNA-CN = 2 × E^ΔCt. E = 1.9915, which is the qPCR efficiency calculated as the mean amplification factor of the two primer probe combinations and ΔCt equals Ct_nuclear gene—Ct_{mitochondrial} gene.

Full-length Lethocerus F2TnC and the two isolated N and C lobes, spanning residues 1–88 and 88–158, respectively, were produced by overexpression in Escherichia coli. The purification procedure was the same as the ones described previously (25 (link)). In short, all constructs were cloned in a pET24d (M11) expression vector (Novagen) containing an N-terminal hexahistidine tag followed by a tobacco etch virus protease cleavage site. The overexpressed proteins were purified by affinity using nickel-nitrilotriacetic acid resin (Qiagen) in two steps separated by an overnight tag cleavage step using in-house produced tobacco etch virus protease. The proteins were then passed through a size exclusion Superdex75 column in 20 mm Tris-HCl buffer at pH 6.8 with 100 mm KCl to remove any high molecular weight contaminants. Proteins were then concentrated on Vivaspin to 0.8 mm samples. Calcium depletion was achieved by a Chelex100 resin (Sigma) and adding 250 mm EDTA to the solution. The holo samples were obtained by adding a 5-fold molar excess of CaCl₂.