Reverse transcription of mRNA from the siliques was conducted using the FastQuant RT Super Mix (TIAN-GEN, China). The qRT-PCR amplification of randomly chosen genes was performed using a 2 × SYBR Green qPCR Master Mix (US Everbright®Inc., Suzhou, China) on a CFX96 Touch Deep Well™ Real-Time PCR Detection System (Bio-Rad, USA) with three biological replications (Table S1 ). The expression levels of genes were calculated using the 2−ΔΔCt method. The expression level of BnActin7 was used as an internal control to normalize the transcript level.
Fastquant rt super mix
Manufactured by Tiangen Biotech
Sourced in China
FastQuant RT Super Mix is a reagent designed for reverse transcription and real-time quantitative PCR (RT-qPCR) applications. It contains all the necessary components, including reverse transcriptase, DNA polymerase, and reaction buffers, to facilitate efficient and accurate RNA quantification.
Automatically generated - may contain errors
Lab products found in correlation
Sybr green pcr master mix, by Takara Bio (5 mentions)
Sybr green qpcr master mix, by US Everbright (4 mentions)
Cfx96 touch deep well real time pcr detection system, by Bio-Rad (4 mentions)
Trizol reagent, by Thermo Fisher Scientific (4 mentions)
Sybr green pcr master mix, by Tiangen Biotech (3 mentions)
Rnaprep pure tissue kit, by Tiangen Biotech (3 mentions)
Trizol reagent, by Tiangen Biotech (2 mentions)
Plant total rna extraction kit, by Tiangen Biotech (2 mentions)
Rnaprep pure cell bacteria kit, by Tiangen Biotech (2 mentions)
Superreal premix plus, by Tiangen Biotech (2 mentions)
Applied biosystems 7500 real time pcr system, by Thermo Fisher Scientific (2 mentions)
Sybr green qpcr master mix, by Selleck Chemicals (2 mentions)
Miniopticon real time pcr system, by Bio-Rad (1 mentions)
Bugle loop mirna qpcr kit, by RiboBio (1 mentions)
Iq5 manager software, by Bio-Rad (1 mentions)
Superreal premix sybr green kit, by Tiangen Biotech (1 mentions)
C1000 touch thermal cycler, by Bio-Rad (1 mentions)
Nanodrop nd 1000, by Thermo Fisher Scientific (1 mentions)
Superreal premix, by Tiangen Biotech (1 mentions)
Applied biosystems 7500, by Thermo Fisher Scientific (1 mentions)
29 protocols using fastquant rt super mix
1
Quantitative RT-PCR analysis of plant gene expression
2
Quantification of miR-125b and Associated Targets
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
TRIzol® reagent (Tiangen Biotech Co., Ltd.) was used to isolate total RNA. A total of 2 µg of each RNA sample was reverse transcribed into cDNA using FastQuant RT Super mix (Tiangen Biotech Co., Ltd.). qPCR was performed on a Bio-Rad MiniOpticon Real-Time PCR system (Bio-Rad Laboratories, Inc.) using a SYBR Green PCR Master mix (Tiangen Biotech Co., Ltd.). A Bugle-Loop™ miRNA qPCR kit (Guangzhou RiboBio Co., Ltd.) was used to quantify miR-125b and U6. Hsa-mir-125b-1_1_PR miScript Precursor Assay (Qiagen GmbH) was used for quantification of precursor miR-125b. The primer sequences were as follows: GAPDH forward, 5′-AGCCACAATCGCTCAGACAC-3′ and reverse, 5′-GCCCAATACGACCAAATCC-3′; Ago2 forward, 5′-CCTCCCATGTTTACAAGTCG-3′ and reverse, 5′-TCTTTGTCCTGCCACAATG-3′; STAT3 forward, 5′-CATATGCGGCCAGCAAAGAA-3′ and reverse, 5′-ATACCTGCTCTGAAGAAACT-3′; GUSB forward, 5′-AGCGTGGAGCAAGACAGTG-3′ and reverse, 5′-TCTGCATAGGGGTAGTGGCT-3′; and Pri-miR-125b forward, 5′-TGAACCTCGAACAGAAATTGCC-3′ and reverse, 5′-TCCACCAAATTTCCAGGATGC-3′.
3
Quantifying Gene Expression in Plants
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To confirm the candidate gene expression pattern, a plant total RNA extraction kit (Tiangen, Beijing, China) was used to extract total RNA from roots and leaves at the fifth true leaf stage of ‘FT’ and cwm seedlings. The FastQuant RT Super Mix (Tiangen, Beijing, China) was used to synthesize cDNA. The primer RT-1 designed by Primer Premier 5.0 (Table S3 ) and the SYBR Green PCR Master Mix (Takara Bio Inc., Kusatsu, Japan) were used for qRT-PCR. The data were analyzed using QuantStudioTM Real-Time PCR software. The program and reaction volume of the qRT-PCR were described previously [42 (link)].
4
Gene Expression Analysis in Mutant Plants
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To analyze the expression pattern of the candidate gene, total RNA was extracted from roots and leaves at different periods, and from stems, flowers, and flower buds in mutant lcm and wild-type ‘FT’. First-strand cDNA was synthesized using the FastQuant RT Super Mix (TIANGEN, Beijing, China). The cDNA was used as a template for qRT-PCR with the SYBR Green PCR Master Mix (TaKaRa, Dalian, China). The qRT-PCR primers are shown in Table S5 . The reaction volume and PCR program were as described by Huang et al.49 (link). The melting curves were established to detect primer dimers. The relative gene expression data were calculated using the 2−ΔΔCt method56 (link). All reactions were performed using three biological replicates and the data were analyzed using the Bio-Rad IQ5 Manager software.
5
Comprehensive Rice Transcriptome Analysis Across Growth Stages
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from different tissues (including the roots, stems and leaves of rice seedlings (2 weeks) in the vegetative growth period, and panicles of 0.5, 2, 4, 8, 16 and 22.5 cm in the reproductive growth period, and panicles of 1, 5, 10 and 25 days after fertilization) using the RNeasy Plant Mini Kit (cat. nos. 74903 and 74904) according to the manufacturer’s instructions. 2 μg of total RNA was reverse‐transcribed into first‐strand cDNA with FastQuant RT Super Mix (#KR108; Tiangen, Beijing, China). qRT‐PCR was performed with a C1000 TouchTM Thermal Cycler (#785BR05170, Bio‐Rad, Hercules, CA) and SuperReal PreMix (SYBR Green) kit (#FP204‐02; TIANGEN). OsActin1 was used as a reference gene. Three biological replicates were performed. The primers used here were listed in Table S10 .
6
Quantifying Gene Expression in Cultured Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total ribonucleic acid (RNA) from cultured cells or tissues was extracted using Trizol reagent according to the manufacturer’s instructions. The total RNA was measured by a NanoDrop ND‐1000 spectrophotometer (Thermo Scientific, Waltham, MA, USA) and retrotranscribed immediately by the FastQuant RT Super Mix (KR108; TIANGEN Biotech, Beijing, China). Quantitative polymerase chain reaction (qPCR) was used with ABI PRISM 7500 fast real‐time PCR system (Applied Biosystems, Foster City, CA, USA) and the SuperReal PreMix (FP204; TIANGEN Biotech). GAPDH messenger RNA was considered the control. The primers for AMPK in quantitative real‐time PCR experiments were as follows: the forward primer F; 5′‐GGATCTTCTTCACGCCTCAG‐3′, and reverse primer R; 5′‐ TCCTCCCGAATCTCTTTG ATG‐3′. Primers for p53 were the forward primer F; 5′‐ATAAGAGTG GAGGGCAATCAGCGA‐3′, and reverse primer R; 5′‐AGTGATGATTGTGAGGATGGGCCT‐3′. Primers for Klf2 were the forward primer F; 5′‐CAGAATAACAGACGACGAAGA‐3′, and reverse primer R; 5′‐CGAGTCCGAGATTGTCAGA‐3′. Primers for GLUT12 were the forward primer F; 5′‐TACGGACGACGCTTACCAT‐3′, and reverse primer R; 5′‐GCCACTGACATCCCAACCA‐3′.
7
Quantitative Gene Expression Analysis in Xoo
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA isolation and qRT-PCR analysis were performed as described previously with some modifications [8 (link)]. Briefly, Xoo strains were grown in M210 liquid medium at 28 °C till OD600 of 0.8, and harvested by centrifugation at 12,000 g for analysis of gene expression. For T3SS-related gene assays, the harvested bacterial cells were sub-cultured in XOM2 medium [43 (link)] overnight at 28 °C and collected again. Total RNA was extracted with RNAprep pure Cell/Bacteria Kit (Tiangen, Beijing, China) and treated with DNase and cDNA was synthesized from total RNA using the FastQuant RT Super Mix (Tiangen, Beijing, China). RT-qPCR was performed using Quant qRT-PCR kit (Tiangen, Beijing, China) in Applied Biosystem’s 7500 (Applied Biosystems, Foster City, CA, USA) with gene specific primers, and gyrB was used as a reference gene (Additional file 2 : Table S1). The relative expression ratio was calculated using 2–∆∆Ct method [44 (link)]. These experiments were performed in three biological replicates and triplicate PCR.
8
Quantitative Real-time PCR (qRT-PCR) Procedure
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Quantitative Real-time PCR (qRT-PCR) was performed using Agilent Technologies Stratagene Mx3005P (USA). Total RNA was isolated using RNA Purification Kit (TianGen, Beijing, China). Total RNA was reverse transcribed at 42 °C for 15 min using Fast Quant RT Super Mix (TianGen, Beijing, China) to obtain cDNA. The cDNA was then diluted 40 times and amplified using Trans Start® Green qPCR Super Mix (Transgen, Beijing, China). GAPDH was taken as the internal control. The program for PCR reactions were: 94 °C for 10 min followed by 40 cycles of 94 °C for 30 s, 54 °C for 30 s and 72 °C for 30 s. The primers for real-time PCR are shown in Table 1 . At the end of real-time PCR, the CT value of each reaction was provided and the changes in transcriptional level of target gene normalized to GAPDH were calculated by the following formula: Relative mRNA level of target gene (folds of control) = 2−ΔΔCT
9
Quantitative Expression Analysis of Candidate Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The expression of candidate genes was detected, using quantitative real-time (qRT)-PCR. Total RNA was extracted from the leaves of mutant and wild-type plants, using the plant total RNA extraction kit (Tiangen, Beijing, China). Single-stranded RNA was reverse transcribed into cDNA, using FastQuant RT Super Mix (Tiangen, Beijing, China); gene-specific primers designed using Primer Premier 5.0 (Supplementary Table S6 ) were used for qRT-PCR with SYBR Green PCR Master Mix (Takara Bio Inc., Kusatsu, Japan). The reaction mix (20 μL) included 10 μL of 2 × UltraSYBR mixture, 0.8 μL of diluted cDNA, 0.4 μL of forward and reverse primers, and 8.4 μL of double-distilled H2O. The ACTIN gene was used as internal standard, and the reaction proceeded under the following conditions: 95°C for 10 min, followed by 40 cycles at 95°C for 15 s, 60°C for 1 min, 95°C for 15 s, 60°C for 1 min, 95°C for 15 s, and 60°C for 15 s. All reactions included three biological and two technical replicates.
10
Quantifying SLC39A4 mRNA in ESCC
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA in clinical tissue samples (21 cases of ESCC specimens and 21 cases of normal esophageal tissues) and ESCC cells were extracted using TRIzol reagent (Thermo Fisher Scientific, Waltham, MA, USA) according to the manufacturer’s instruction and then were reversely transcribed to cDNA using FastQuant RT Super Mix (TIANGEN Biotech, Beijing, China). The mRNA of SLC39A4 was detected on Applied Biosystems 7500 Real-Time PCR System (Thermo Fisher Scientific) by using SYBR® Premix Ex Taq™ II (TaKaRa, Dalian, China). GAPDH was used as an internal control. The primer pairs of target mRNAs were as follows: SLC39A4, F: 5ʹ- CGAGGTCCCTATGACGCTG-3ʹ and R: 5ʹ-CACTCAGGCATACCGTGTCC-3ʹ, GAPDH, F: 5ʹ-TGCACCACCAACTGCTTAGC-3ʹ and R: 5ʹ-GGCATGGACTGTGGTCATGAG-3ʹ.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!