Taqman MicroRNA Assay (ThermoFisher Scientific Carlsbad, CA) was used to analyze the expression of miR-378a-3p, miR-378c, and miR-422a and the endogenous control RNU43 at full reaction volume (20 μl) according to the manufacturer's instructions. To evaluate the levels of each mRNA, the total cDNA was reverse transcribed from 1 μg of RNA using 1 unit of reverse transcriptase (Agilent Technologies). Quantitative real-time PCR for IL-33, IL-8 AGO1, AGO2, PPARGC1B, and 18s rRNA genes were performed using II Brilliant SybrGreen qPCR Master Mix (Agilent Technologies). Primer sequence for IL-33 Fwd GTGACGGTGTTGATGGTAAGATGT, Rev CACTCCAGGATCAGTCTTGCAT; PPARGC1B Fwd TGTTCAGACAGAACGCCAAG, Rev AAGCCGTACTTCTCGCCTCT; IL-8 Fwd TCTGGACCCCAAGGAAAACT, Rev TTGCATCTGGCAACCCTACA; AGO1 Fwd GGTCCAGCATTTCAAGCCTCAGAT, Rev CACAATGGCTAGCCACTTGATGGA; AGO2 Fwd GGGGCAGGAATAAAGCTATTGCGA, Rev TGCGCGTATTTGCAGAAGCAC; 18s ribosomal RNA (rRNA) Fwd GTGGAGCGATTTGTCTGGTT, Rev CGCTGAGCCAGTCAGTGTAG. The 18s rRNA was used as a reference gene to normalize mRNA levels. Each sample was measured by duplicated with qPCR results analyzed by the ΔΔCq method.
Reverse transcriptase
Manufactured by Agilent Technologies
Sourced in United States
Reverse transcriptase is an enzyme that catalyzes the synthesis of complementary DNA (cDNA) from an RNA template. It is a key component in various molecular biology techniques, such as gene expression analysis and cDNA library construction.
Automatically generated - may contain errors
2 protocols using reverse transcriptase
1
Comprehensive miRNA and mRNA Expression Analysis
2
Gene Expression Profiling After tMCAO
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from ipsilateral brain hemisphere at 1 and 3 days after tMCAO challenge using TRI reagent (Sigma-Aldrich). For qRT-PCR, RNA (1 μg) was reverse-transcribed in a reaction mixture containing 3 mM MgCl2, 1 U RNase inhibitor, 0.5 mM dNTP, 1x RT buffer, 500 ng of random primers, and 10 U reverse transcriptase (Agilent, Santa Clara, CA, USA). The synthesized cDNA was used as a template for qRT-PCR using StepOnePlusTM qRT-PCR system (Applied Biosystems, Foster City, CA, USA) and gene-specific primers (Supplementary Table 1 ).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!