Sybr green dna binding dye

Bees of each sample were placed in a 15 mL plastic bottle together with 5–10 steel bearing balls. Using a technique adapted from plant virology, the samples were freeze dried, homogenized in a genogrinder and thereafter, RNA was extracted according to the manufacturer’s manual (for details see [13 (link)]). Following RNA extraction, a two-step real-time RT-PCR assay was used to detect and quantify seven honey bee viruses, BQCV, CBPV, SBV, DWV, ABPV, KBV, and IAPV. The three closely related viruses of the ABPV complex (ABPV, KBV and IAPV) were detected in a single assay (AKI) [51 (link)]. The housekeeping gene, β-Actin, was used as an internal control, where the presence and quantification of this reference gene ensured that the entire procedure from extraction to quantification was done without degradation of RNA [13 (link)].
Quantitative PCR amplifications were carried out on a vii7 apparatus (Applied Biosystems) in duplicate for each sample using SYBR Green DNA binding dye. Final volumes of 12μL with a primer concentration of 0.4μM were loaded on optical 384 well PCR plates. Primers [30 , 47 (link), 51 (link)–53 (link)] used in this study are listed in Table 1.

Animals from the locomotor activity monitoring chamber were anesthetized and decapitated under darkness between 1 h before and after the lights off time. The brain was isolated and immersed in ice-cold HBSS within 15 s after decapitation under dim light. Basic RNA sampling and RT-qPCR methods follow our previous protocol^{2 (link)}. Whole bilateral pairs of SCN, 4V CP, and LV CP were dissected out in HBSS and each sample was transferred to 50 µl TRK lysis buffer (Omega Bio-Tek) and stored immediately at −80 °C. Total RNA was microcolumn-purified using the ENZA total RNA kit (Omega Bio-Tek) with the final elution volume of 20 µl in DEPC water. cDNA was synthesized from total RNA of 113.4 ± 18.4 ng (SCN), 318.2 ± 3.1 ng (4V CP), and 308.5 ± 5.2 ng (LV CP) (mean ± SEM) using SuperScript II RT (Thermo Fisher Scientific) with random primers. GAPDH was chosen as the internal control for each sample. RT-qPCR was performed in triplicate with SYBR Green DNA binding dye on StepOnePlus (Applied Biosystems). The following primer sequences were used (5′–3′): GAPDH forward ACGGGAAGCTCACTGGCATGG CCTT, GAPDH reverse CATGAGGTCCACCACCCTGTTGCTG; mBmal1 forward GCAGTGCCACTGACTACCAAGA, mBmal1 reverse TCCTGGACATTGCATTGCAT. Additional methods used for Supplementary Fig. 14 are described in Supplementary Methods.