Extremegene 9 transfection reagent

The human RHBDL2-specific shRNAs were described previously^{8 (link)}. To generate the lentivirus, 2.6 µg of pLKO.1 plasmids encoding an shRNA targeted against human RHBDL2 (sh01) or empty vector were co-transfected alongside 1.8 µg pCMVΔ8.91 and 0.78 µg pMD-VSVG into HEK cells using ExtremeGene 9 transfection reagent (Roche). The viral particles were allowed to accumulate in the media for approximately 48 hr and then filtered through a 0.45 µm PES membrane, diluted fourfold with DMEM and supplemented with 10 µg/ml Polybrene. Target HeLa cells were incubated with this viral solution for 24 hr at 37 °C and then selected by exchanging the medium for DMEM supplemented with 2.5 µg/ml puromycin.

2.0X10⁵ cells were seeded in 60 mm culture dishes 24 h prior to transfection. Cells were incubated overnight with transfection mixture containing 1.5 μg HIF-1 pTL-Luc (5’-3’: GTGACTACGTGCTGCCTAGGTGACTACGTGCTGCCTAGGTGACTACGT GCTGCCTAGGTGACTACGTGCTGCCTAG; Affymetrix, LR0128) and 0.1 μg pSV-β-galactosidase plasmids (Clontech) and eXtreme Gene 9 transfection reagent (Roche) following the manufacturers protocol in OptiMEM Reduced Serum media (Invitrogen). Transfection media was replaced with standard RPMI the following day, and cells treated as described. Luciferase activity was measured using the Luciferase Assay Kit (Promega) and normalized against β-galactosidase activity that was measured using the β-galactosidase Assay Kit (Promega). Luciferase and β-gal were measured separately on a SpectraMax M2e 96-well plate reader.