Aurum kit

Total RNA isolated using the AURUM kit (Bio-Rad) was converted into cDNA and labelled with the KAPA SYBR FAST universal one-step qRT-PCR kit (Kappa Biosystems, Woburn, MA, USA).
PCR primers for KlNDI1 were designed with the tool ‘Primer Blast’ at NCBI to generate 80–120 base pairs amplicon. Primer length of 18–24 bp, Tm of 59 or 60°C and G/C content not higher than 50% were selected. The sequence of primers chosen is GAATACTTGGCTAAGGTCTTCGAC (forward) and CTTGAATGGCTTGAAACCGTTTTC (reverse). The specificity of the primers for the KlNDI1 cds was verified.
The ECO Real-Time PCR System was used for the experiments (Illumina, San Diego, CA, USA) and calculations were made by the 2-ΔΔCt method (Livak and Schmittgen, 2001 (link)). Two independent cultures and RNA extractions were assayed for each strain or condition. The mRNA levels of the KlNDI1 gene were corrected by the geometric mean of the mRNA levels of the gene ACT1, a control gene also used for RT-PCR experiments as above described, which was previously verified to be constitutive in the assayed conditions. A t-test was applied to evaluate the differences between ΔCt values (Ct values normalized with reference genes) of control and treated samples with a P value of 0.05.

The following kits were tested for the evaluation of the most effective RNA isolation: ZR Quick-RNA MicroPrep (catalogue #R1051, Zymo Research, CA,.), RNeasy Micro Kit (catalogue #74004, Qiagen, Hilden, Germany), TRIzol Reagent (catalogue #15596-026, Invitrogen Life Technologies, Carlsbad, CA, U.S.A.), and the Aurum Total RNA Mini Kit (catalogue #732-6820, Bio-Rad, Hercules, CA, U.S.A.). In addition, the following procedures were evaluated: TRIzol protocol using a half volume of all reagents, Trizol in combination with RNeasy Mini kit (Qiagen), Trizol plus PureLink RNA Mini Kit (catalogue #12183018A, Invitrogen, Carlsbad, CA, U.S.A.), and RNAlater in sequential integration with the Aurum kit (Bio-Rad). RNA purification was followed according to the kit instructions, and deviations from the recommended preparation of the starting material are reported in the Results section. Protocol modifications to the Aurum kit and Trizol protocols facilitated the optimization of RNA purification. Here, parameters related to homogenization duration, disruption method, number of tissues per tube, and volume of reagents were modified.

Total RNA was isolated from infected OCI-AML2 cells using the RNEasy plus kit (Qiagen) or an Aurum kit (Bio-Rad Laboratories, Inc.) Cells were assessed at 4 or 6 days post-infection for the shRNA studies, or at 24 hours after 2-CM. cDNA was synthesized using random priming and Superscript III (Life Technologies.) TaqMan analysis of genes ND3, ND6, CO2, ATP8 and 18S was performed using primers and probes (Applied Biosystems, Inc.) and Taqman Gene expression master Mix (Applied Biosystems) and an Applied Biosystems 7500 Real Time PCR instrument. Standard curves with variable amounts of cDNA input were conducted to confirm linearity of response. Experiments were performed in triplicate and relative expression was determined using the delta delta Ct method. Mitochondrial gene expression was normalized to 18S expression, and data were expressed relative to shGFP controls. RNA content was determined using A260/280 on a Nanodrop spectrophotometer (Thermo Scientific).
For spRNAP-IV expression, primers p2 (Intron 1 forward) GTGGTTTCTTATGCAGCCTC gtggtttcttatgcagcctc and p3 (exon 3 reverse) ATCCTTCTCCAGTATCTTTGC were employed. KiCqStart Master Mix (Sigma) was utilized, with amplification in a BioRad CFX96 Real-time PCR machine, and expression was normalized to 18S.