The largest database of trusted experimental protocols

Pe conjugated anti cd33

Manufactured by BD
Sourced in United States, United Kingdom

PE-conjugated anti-CD33 is a monoclonal antibody that binds to the CD33 antigen. CD33 is a cell surface protein expressed on myeloid cells, including monocytes, granulocytes, and some leukemic cells. The PE (Phycoerythrin) fluorescent dye is conjugated to the antibody, allowing for the detection and analysis of CD33-positive cells using flow cytometry.

Automatically generated - may contain errors

4 protocols using pe conjugated anti cd33

1

Characterizing Myeloid-Derived Suppressor Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
All antibodies were purchased from BD Biosciences (USA) except for phycoerythrin (PE)-conjugated anti-CD33 (Pharmingen, USA), PE-conjugated TCR-ζ mAb (Beckman Coulter Immunotech SAS, France) and fluorescein isothiocyanate (FITC)-conjugated anti-CD3 (Sungene Biotech, China).
The peripheral blood cells were analyzed using protocols previously described by our team, with minor modifications (Zou et al., 2009 (link)). Anti-lin-1-FITC, anti-HLA-DR-peridin chlorophyll protein, anti-CD11b-allophycocyanin (APC), and anti-CD33-PE were used to characterize MDSCs. For phenotypic staining ex vivo, fresh heparinized peripheral blood (200 μl) was labeled with the above-mentioned cocktail of antibodies; matched isotype control antibodies were used as negative controls. After incubation for 30 min at 4°C in the dark, FACS™ lysing solution (BD PharMingen) was added to lyse the red blood cells. After washing twice with phosphate-buffered saline (PBS), the cells were fixed in 1% paraformaldehyde, and four-color flow cytometric analysis was performed using a FACSCalibur flow cytometer (BD Biosciences, USA) and Flowjo software (TreeStar, USA) (Zhang et al., 2010 (link)). At least 200,000 events were acquired per run.
+ Open protocol
+ Expand
2

Quantification of Myeloid-Derived Suppressor Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Evaluation of the MDSC percentage was accomplished with 0.5*106 cells stained with FITC-conjugated anti-CD15, PE-conjugated anti-CD33, PerCP-conjugated anti-HLA-DR, a cocktail of APC-conjugated antibodies anti-CD3, -CD56, -CD19 (Lin), APC-H7-conjugated anti-CD14 and PE-Cy7-conjugated anti-CD11b (BD Biosciences). Acquisition of 100,000 events was performed in the leukocyte-gated population on FACS CANTO II and analyzed with FACS DIVA software (BD Biosciences, USA).
+ Open protocol
+ Expand
3

Flow Cytometry Profiling of PBMCs

Check if the same lab product or an alternative is used in the 5 most similar protocols
PBMCs were thawed briefly in a 37°C water bath before washing with DMEM. Cells were then resuspended in phosphate buffered saline (PBS, pH 7.2) and stained for flow cytometry. For intracellular staining, cells were first stained with surface stains, then fixed and permeabilized with foxp3/transcription factor staining buffer (Invitrogen, Waltham, MA) before staining with intracellular stains. Flow cytometry for PBMCs was run on a BD LSR Fortessa™ flow cytometer (BD Biosciences, San Jose California, USA) and data were collected using BD FACSDiva™ software (BD Biosciences, San Jose California, USA). Data were analyzed using FlowJo Version 10 Software (FlowJo, Ashland, Oregon, USA). The following antibodies were used for staining: PE CF594-conjugated anti-CD15; APCH7-conjugated anti-CD14; PE-conjugated anti-CD33; APC-conjugated anti- HLA-DR, FITC-conjugated anti-Lineage; PE/Cy7-conjugated anti-CD123; PE-conjugated anti-TLR7 (all from BD Biosciences, San Jose, CA); A700-conjugated anti-CD11b (Life technologies, Carlsbad, CA); FITC-conjugated anti-TLR7 and FITC-conjugated anti-Rabbit IgG isotype control (both from Invitrogen, Waltham, MA); biotinylated-anti TLR9 (Abcam, Cambridge, UK); unconjugated anti-human FC block, PerCP/Cy5.5-conjugated Streptavidin; biotinylated anti-Mouse IgG2a and PE-conjugated anti-Mouse IgG1κ (all from eBioscience inc, Santa Clara, CA).
+ Open protocol
+ Expand
4

Lentiviral Transduction of CD34+ Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
CD34+ cells from three to ten distinct cord blood samples were pooled and transduced with lentiviruses (pRRLsin-PGK-eGFP-WPRE, Genethon, Evry, France) expressing the green fluorescent protein and either a short hairpin RNA targeting TET2 (shRNA-TET2, 5′- GGGTAAGCCAAGAAAGAAA -3′) or a scramble sequence (shRNA-scramble, 5′- GCCGGCAGCTAGCGACGCCAT -3′) as control23 (link). Twenty-four hours after transduction, 2 × 105 cells were intravenously injected to sublethally irradiated NSG female mice (6–8 weeks old). Mice were killed 15–17 weeks after injection, and repopulation of mouse bone marrow (femurs and tibias) by human cells was assessed by flow cytometry, using APC-conjugated mouse anti-human CD45, PE-conjugated anti-human CD19, PE-conjugated anti-CD33 (all from BD Pharmingen). Antibodies are listed in the Supplementary Information (Supplementary Table 14).
For NGS experiments and for secondary transplantation, bone marrow of repopulated mice was enriched in human cells using a mouse/human chimera isolation kit (Stem Cell Technologies).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!