To cover the mRNA-NPs with the TransIT-X2 Delivery System (Mirus), the mRNA-NPs were diluted with OPTI-MEMI (Gibco). TransIT-X2 was mixed gently into the reaction solution, and the mixtures were incubated at room temperature for 15 min according to the manufacturer’s instructions.
Transit x2 delivery system
Manufactured by Mirus Bio
The TransIT-X2 delivery system is a versatile transfection reagent designed for efficient nucleic acid delivery into a wide range of cell types. It facilitates the transfer of plasmid DNA, mRNA, and other nucleic acids into cells, enabling researchers to study gene expression, conduct functional assays, and explore various applications in cell biology and biotechnology.
Automatically generated - may contain errors
5 protocols using transit x2 delivery system
1
Encapsulating mRNA with TransIT-X2
2
Silencing Ccl2 and C3 mRNA via RNAi
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA interference (siRNA, small interfering RNA) oligonucleotides were purchased from Integrated DNA Technologies (IDT DNA, Coralville, IA). RNAi duplexes were designed against splice common variants of the target gene and were validated using a dose-response assay with increasing concentrations of the suspended oligo (900–1200 ng/ml) using a standard scrambled dicer substrate RNA (DsiRNA) as control. RNAi oligonucleotides were transfected using the TransIT-X2 delivery system (Mirus Bio, Madison, WI) 48 h before 100 μM MnCl2 treatment. Separate siRNA systems were used to ensure specific knockdown of Ccl2 and C3 mRNA. The Ccl2 dsiRNA duplex sequences are (5′➔3′) UGAAGCUAAUGCAUCCACUACCUTT; UAAACAAUACCUUGGAAUCUCAAACAC (IDT DsiRNA; denoted siCcl2). The C3 dsiRNA duplex sequences are (5′➔3′) UAAUAAAGCUUCAGUUGUAUUUCAA; UUGAAAUACAACUGAAGCUUUAUUAGA (IDT DsiRNA; denoted siC3).
3
Targeted siRNA Knockdown of Nurr1 and Nur77
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA interference (small interfering RNA, siRNA) sequences were acquired from Integrated DNA Technologies (IDT DNA, Coralville, IA). Nurr1 and Nur77 RNAi duplexes were designed against splice common variants of the target gene and were validated using a dose-response assay with increasing concentrations of the suspended oligo (900–1200 ng/ml) using a standard scrambled dicer-substrate RNA (DsiRNA) as control. Astrocytes were transfected with RNAi oligonucleotides using the TransIT-X2 delivery system (Mirus Bio) 48 hours before treatment with MPTP (10 μM), and the inflammatory cytokines TNFα (10 pg/ml) and IFNγ (1 μg/μl), with or without DIM-C-pPhOCH3 (C-DIM5) (10 μM) treatment or vehicle control (dimethylsulfoxide, DMSO), for 4 hours of separate siRNA systems were used to ensure specific knockdown of Nurr1 and Nur77 mRNA while limiting off-target effects on other nuclear receptor family members (Nur77 or Nurr1, respectively, and Nor1). The Nurr1 dsiRNA duplex sequences are (5′→3′) CUAGGUUGAAGAUGUUAUAGGCACT; AGUGCCUAUAACAUCUUCAACCUAGAA (IDT DsiRNA; designated siNurr1) and the Nur77 DsiRNA duplex sequences (5′→3′) UCGUUGCUGGUGUUCCAUAUUGAGCUU; AGCAACGACCACAAGGUAUAACUCG (IDT DsiRNA; designated siNur77).
4
Nurr1 mRNA Knockdown Using siRNA
5
Validation of miR-550a-3-5p Binding to YAP 3' UTR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The human YAP 3′ UTR containing the putative miR-550a-3-5p binding site was cloned into the XbaI and EcoRV sites of pGL3luc (provided by Dr. V.N. Kim, Seoul National University, Korea). The following primers were used for the amplification of the YAP 3′ UTR: forward, 5′-ACCCGCGG GTTATAGAGCCCTCAGGCAGAC-3′ and reverse, 5′-ACAGATATC TGTAAGTACCTAACATATGAGC-3′. To generate the mutant reporter vector, four nucleotide mutations were introduced into the putative miR-550a-3-5p binding site by using VELOCITY DNA Polymerase (Bioline, USA) in accordance with the QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies, CA) instruction manual.
8xGTIIC-luciferase plasmid was provided by Dr. Stefano Piccolo (University of Padua; Addgene plasmid #34615). HCT116 cells were transfected with the reporter plasmid (100 ng), pRL-CMV-Renilla plasmid (1 ng), and miR-550a-3-5p (20 nM) in 24-well plates by using the TransIT-X2 Delivery System (Mirus, Madison, WI) in accordance with the manufacturer’s protocol. After 24 h, luciferase assays were conducted by using the Dual Luciferase Reporter Assay system (Promega, WI) in accordance with the manufacturer’s instructions. The firefly luciferase activity was normalized to Renilla luciferase activity.
8xGTIIC-luciferase plasmid was provided by Dr. Stefano Piccolo (University of Padua; Addgene plasmid #34615). HCT116 cells were transfected with the reporter plasmid (100 ng), pRL-CMV-Renilla plasmid (1 ng), and miR-550a-3-5p (20 nM) in 24-well plates by using the TransIT-X2 Delivery System (Mirus, Madison, WI) in accordance with the manufacturer’s protocol. After 24 h, luciferase assays were conducted by using the Dual Luciferase Reporter Assay system (Promega, WI) in accordance with the manufacturer’s instructions. The firefly luciferase activity was normalized to Renilla luciferase activity.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!