Reference RT-PCR examinations were performed with purified samples using a method developed by the National Institute of Infectious Diseases (NIID), Japan, for SARS-CoV-2 [17 (link), 18 (link)], which was used Briefly, 5 μL of the extracted RNA was used for one-step quantitative RT-PCR with the THUNDERBIRD® Probe One-step qRT-PCR kit (TOYOBO Co., Ltd.) and the LightCycler® 96 Real-time PCR System (Roche Diagnostics KK, Basel, Switzerland). A duplicate analysis for N2 genes was performed for the evaluation of SARS-CoV-2. EDX SARS-CoV-2 Standard (Bio-Rad Laboratories, Inc., Hercules, CA, USA) and sterile purified water (Merck & Co., Inc., Kenilworth, NJ, USA) were used as positive and negative controls, respectively. The calibration curves were generated with 5, 50 and 500 copies/reaction of EDX SARS-CoV-2 Standard.
Edx sars cov 2 standard
Manufactured by Bio-Rad
Sourced in United States
The EDX SARS-CoV-2 Standard is a laboratory reference material designed for use in the validation and quality control of diagnostic tests for the detection of SARS-CoV-2, the virus that causes COVID-19. This product provides a consistent and reliable source of SARS-CoV-2 genetic material for use in assay development, optimization, and performance evaluation.
Automatically generated - may contain errors
Lab products found in correlation
Thunderbird probe one step qrt pcr kit, by Toyobo (2 mentions)
Trizol, by Thermo Fisher Scientific (2 mentions)
Lightcycler 96 real time pcr system, by Roche (1 mentions)
Lightcycler 96 system, by Roche (1 mentions)
Direct zol rna mini kit, by Zymo Research (1 mentions)
Trizol, by Zymo Research (1 mentions)
Prism 7 v7, by GraphPad (1 mentions)
4 protocols using edx sars cov 2 standard
1
SARS-CoV-2 Quantitative RT-PCR Protocol
2
Comparing SARS-CoV-2 Viral Loads in Nasal Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We conducted an additional experiment to evaluate whether the viral loads differed between sample collection sites and swab types between January 8 and 19, 2021. After receiving the participants’ informed consent, two anterior nasal samples were obtained from the participants for whom a nasopharyngeal sample had already tested positive for SARS-CoV-2. Two anterior nasal swab samples were collected from each nostril using one with a NP-type swab and the other with an oropharyngeal-type flocked (OP-type) swab. These sample collections were performed on the same day.
The samples were diluted in 3 mL of UTM, and stored at − 80 °C. After several days of storage, the samples were thawed, and purification and RNA extraction were performed according to the above-described method. The viral concentrations in samples were quantified with the following procedure. The calibration curves were generated with 5, 50, and 500 copies/reaction of positive control (EDX SARS-CoV-2 Standard; Bio-Rad Laboratories, Inc., Hercules, CA, USA). Quantitative RT-PCR was performed on a LightCycler 96 System (Roche, Basel, Switzerland) using a THUNDERBIRD Probe One-step qRT-PCR Kit (TOYOBO Co. Ltd., Osaka, Japan) with a primer/probe N2 set.
The samples were diluted in 3 mL of UTM, and stored at − 80 °C. After several days of storage, the samples were thawed, and purification and RNA extraction were performed according to the above-described method. The viral concentrations in samples were quantified with the following procedure. The calibration curves were generated with 5, 50, and 500 copies/reaction of positive control (EDX SARS-CoV-2 Standard; Bio-Rad Laboratories, Inc., Hercules, CA, USA). Quantitative RT-PCR was performed on a LightCycler 96 System (Roche, Basel, Switzerland) using a THUNDERBIRD Probe One-step qRT-PCR Kit (TOYOBO Co. Ltd., Osaka, Japan) with a primer/probe N2 set.
3
SARS-CoV-2 RNA Detection in Murine Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Equal volumes of BAL from each mouse was mixed with Trizol (Thermo Fisher). RNA was extracted using Direct Zol RNA mini kit (Zymo Research), and analyzed for the content of SARS-CoV-2 RNA by RT-qPCR using the following primers/probes as previously described [47] (link). SARS-CoV-2 E gene: forward: ACAGGTACGTTAATAGTTAATAGCGT; reverse: ATATTGCAGCAGTACGCACACA; probe: FAM- ACACTAGCCATCCTTACTGCGCTTCG-MGB.
Lung tissue was lysed in Trizol and RNA was extracted using Direct Zol RNA mini kit (Zymo research). The copy number of SARS-CoV-2 RNA was determined by analysing 5 ng of RNA from each lung tissue sample, using E gene RNA transcripts of a defined copy number (EDX SARS-CoV-2 Standard, Biorad) to generate a standard curve. Primers and probes as above.
Lung tissue was lysed in Trizol and RNA was extracted using Direct Zol RNA mini kit (Zymo research). The copy number of SARS-CoV-2 RNA was determined by analysing 5 ng of RNA from each lung tissue sample, using E gene RNA transcripts of a defined copy number (EDX SARS-CoV-2 Standard, Biorad) to generate a standard curve. Primers and probes as above.
4
Determining SARS-CoV-2 Assay Limit of Detection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The OmniSARS2 assay limit of detection (LoD) with 95% confidence level was determined using a commercially available RNA standard reference, EDX SARS-CoV-2 Standard (SKU: COV019, BioRad Inc., Hercules, CA, USA) with fourteen data points, each with fifteen replicate reactions and calculated using probit regression (dose–response analysis) with the software MedCalc® v20.011. The EDX SARS-CoV-2 Standard contains synthetic RNA transcripts of SARS CoV-2 E, N, ORF1ab, RdRP and S genes, each quantitated at 200,000 copies/mL and human genomic DNA at 75,000 copies/mL. Fourteen serial ½ dilutions of the EDX SARS-CoV-2 Standard were performed up to a dilution concentration of 24 copies/mL of the SARS-CoV-2 genes. The linearity and efficiency for the quadruplex qRT-PCR were analyzed by Design and Analysis Software, Version: 2.4.3 (©2020 Thermo Fisher Scientific, Waltham, MA, USA) including linear regression and absolute quantification analysis. Spearman correlation coefficient of OmniSARS2 and two commercial kits (FOSUN and TaqPath) were measured using the average cycle quantification (Cq) values of the different SARS-CoV-2 genes present in each method, with matching clinical sample. Correlation coefficient, plots and significance were performed using GraphPad Prism 7 v7.04 (San Diego, CA, USA).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!