Total RNA was isolated from TA muscles or C2C12 myoblasts using TRIzol reagent (Thermo Fisher Scientific). Total RNA concentration was determined using Qubit 4 (Thermo Fisher Scientific). Purified RNA (2 μg) was subjected to reverse transcription using Moloney murine leukemia virus reverse transcriptase (Promega). Expression of the gene of interest was determined using SYBR Green-based qRT-PCR (Takara), performed on a BIORAD iCycler iQ5 (Bio-Rad). Primer sequences used for qRT-PCR are listed in Table S3 . Gene expression levels were calculated from threshold cycle (Ct) values using the 2−△△Ct method, with GAPDH as an internal control.
Sybr green based qrt pcr
Manufactured by Takara Bio
SYBR Green-based qRT-PCR is a laboratory equipment product used for real-time quantitative reverse transcription polymerase chain reaction (qRT-PCR) analysis. It utilizes the SYBR Green dye to detect and quantify target gene expression in RNA samples.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (2 mentions)
Biorad icycler iq5, by Bio-Rad (1 mentions)
Qubit 4, by Thermo Fisher Scientific (1 mentions)
Moloney murine leukemia virus reverse transcriptase, by Promega (1 mentions)
Rabbit anti atg5, by Cell Signaling Technology (1 mentions)
Mouse anti ub, by Santa Cruz Biotechnology (1 mentions)
Rabbit anti lc3b, by Proteintech (1 mentions)
Rabbit anti dj 1, by Abcam (1 mentions)
Rabbit anti sqstm1, by Cell Signaling Technology (1 mentions)
Mouse anti parkin, by Santa Cruz Biotechnology (1 mentions)
Primescript rt reagent kit, by Takara Bio (1 mentions)
Anti β actin, by Merck Group (1 mentions)
Rneasy mini kit, by Qiagen (1 mentions)
2 protocols using sybr green based qrt pcr
1
Quantitative gene expression analysis
2
Quantitative RT-PCR and Western Blot Analysis of Liver Tissues
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA of liver tissues was isolated with the RNeasy Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. Eight hundred nanograms total RNA was reverse-transcribed into cDNA using the PrimeScript RT reagent Kit (Takara, Tokyo, Japan) following the manufacturer’s instructions. The PCR amplification products were quantified by SYBR-green based qRT-PCR (Takara) following a standard procedure. The mRNA expression levels of target genes were normalized by β-Actin. Primer sequences are provided in Table 1 .
Primers Used for qRT-PCR
| Gene | Sequence 5′—3′ forward | Sequence 5′—3′ reverse |
|---|---|---|
| β-Actin | GTGACGTTGACATCCGTAAAGA | GCCGGACTCATCGTACTCC |
| Il-6 | GCTACCAAACTGGATATAATCAGGA | CCAGGTAGCTATGGTACTCCAGAA |
| Il-1β | TGTAATGAAAGACGGCACACC | TCTTCTTTGGGTATTGCTTGG |
| Tnfα | TTCTATGGCCCAGACCCTCA | TTTGCTACGACGTGGGCTAC |
| Dj-1 | GTGCAGTGTAGCCGTGATGT | CCTCCTGGAAGAACCACCAC |
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!