Pparg

Mouse front limbs (CD1 strain) were collected as fresh post mortem samples. Stages E12, E15, and E18 were examined. Histological sections were deparaffinized in xylene and rehydrated in a gradient series of ethanol. Sections were pre-treated in citrate buffer (10 min/98 °C) for antigen retrieval and then incubated with Caspase-1 p20 (Cleaved Asp296) Antibody (PA5-99390, Thermo Fisher Scientific) overnight. The primary antibody was followed by incubation with secondary anti-rabbit antibody Alexa Fluor^® 488 (Thermo Fischer Scientific, Waltham, MA, USA) for 40 min at RT. Nuclei were detected by ProLong^® Gold Antifade reagent with DAPI (Thermo Fischer Scientific).
For immunocytofluorescence, micromass cultures were grown on culture glass and fixed by 4% paraformaldehyde. Primary antibodies for Caspase-1 p20 (PA5-99390, Thermo Fisher Scientific), Cd36 (PA1-16813, Thermo Fisher Scientific), Pparg (2443, Cell Signaling Technology, Danvers, MA, USA), and Rankl (PA5-110268, Thermo Fisher Scientific) were diluted in the range 1:50–1:200 and were applied overnight/4 °C. Alexa Fluor^® 488 or 568 (A11034, A10037, Thermo Fischer Scientific) was diluted at 1:200 and then applied for 40 min/RT. The cytoskeleton was visualized by ActinGreenTM 488 ReadyProbesTM Reagent (Thermo Fischer Scientific), and nuclei were detected by ProLong^® Gold Antifade reagent with DAPI (Thermo Fischer Scientific).

RF24 cells were cultured in a hypoxic condition for 16 h. After hypoxic culture, ChIP assays were performed by using an EZ ChIP^TM kit (Millipore, Temecula, CA) according to the manufacturer’s instructions. In brief, cross-linked cells were collected, lysed, sonicated, and subsequently subjected to immunoprecipitation with PPARG (Cell Signaling) antibody or IgG control. Immunocomplexes were collected with protein G agarose beads and eluted. Cross-links were reversed by incubating at 65 °C. DNA was then extracted and purified for subsequent PCR amplification with the use of gene-specific primers. Negative control forward: GCAGTGAGAAAGCAGGTTTG, negative control reverse: CATAATCCAGGGTCATGGTG. PPARG binding region forward: TCCTTTCCTCTGGAACATGC, PPARG binding region reverse: TAAGAGGAGGGACAAAGACAGG.

Antibodies against mTOR, phospho-mTOR, IRS2, AKT, phospho-AKT-308, NF-kappaB, phospho-NF-kappaB, JNK, phospho-SAPK/JNK (Thr183/Tyr185), PPAR-g, F4/80, SREBP, and GAPDH were purchased from Cell Signaling Technology (USA).

Total protein from both the placental samples and trophoblast cells was extracted using RIPA lysis buffer, and quantified using the Bradford method (Thermo Fisher Scientific, Waltham, MA, USA). A total of 20 μg protein of each sample was electroblotted onto PVDF membranes (Millipore, Burlington, MA) after sodium dodecyl-sulfate polyacrylamide gel electrophoresis (SDS-PAGE) separation [12 (link)]. Protein signals were developed using an enhanced chemiluminescence kit (Bio-Rad, Irvine, CA) and quantified with a ChemiDoc system (Bio-Rad, Irvine, CA). The primary antibodies and dilutions are listed as following: rabbit polyclonal antibodies against adiponectin (1:500, Proteintech, Wuhan, China), fatty acid binding protein 4 (FABP4) (1:1000, Abcam, Cambridge, UK), peroxisome proliferator activated receptor gamma (PPARg) (1:1000, Cell Signaling Technology, Boston, MA, USA), acetyl-CoA carboxylase (ACC) (1:1000, Cell Signaling), ERK1/2 (1:1000, Cell Signaling), phospho-ERK1/2 (1:1000, Cell Signaling), low density lipoprotein receptor (LDLR) (1:1000, Thermo Fisher), mouse monoclonal antibodies against sterol regulatory element-binding protein 2 (SREBP2) and sterol regulatory element-binding protein 1 (SREBP1) (1:1000, Santa Cruz Biotechnology, Santa Cruz, CA, USA), β-actin (1:5000, Sigma-Aldrich) and sortilin 1 (SORT1) (1:1000, BD Bioscience, Ann Arbor, MI, USA).

Whole cell lysates were electrophoretically separated on denaturing polyacrylamide gels and transferred to polyvinylidene difluoride membranes. Proteins were detected with USF1 (sc-229, Santa Cruz Biotechnology), FLAG (F1804, Merck), PPARg (2443, Cell Signaling Technology), SREBP1 (sc-365514, Santa Cruz Biotechnology), FASN (3180 Cell Signaling Technology), and β-actin antibody (G043, abm).

Tissues were lysed on ice in lysis-buffer (50 mM Tris-HCl, 150 mM NaCl, 1 mM EDTA, 6 mM EGTA, 20 mM NaF, 1% Triton X-100, and protease inhibitors) for 15–20 min. After centrifugation at 13000 rpm for 15 min, supernatants were collected for protein determinations and SDS-PAGE analysis. The following antibodies were used: pS245-Hdac4 (#3443), Hdac4 (#7628), Sik2 (#6919), Cox4 (4850), Pparg (#2435), and phosphor-PKA substrate (#9624) antibodies (Cell Signaling Technology), Hsp90 (Santa Cruz Biotechnology, #SC-7947), Ucp1 (Sigma, U6382), mt-Co1 (Abcam, #ab110413), mt-Co2 (Proteintech, #55070–1-AP), Cox5b (Bethyl, #A-305–523A), Cox6b (Abgent, #AP20624a), Hsp60 (Bethyl, #A302–846A), Hk1 (Proteintch, #19662-1-AP). Immunoblots were quantified using Image J software.