Total RNA was extracted from CRC cells using Maxwell® RSC miRNA Tissue Kit (Promega), according to the manufacturer’s protocol. The quantification and quality analysis of RNA was performed by Thermo Scientific Nanodrop 1000 and Bioanalyser 2100 (Agilent). DNA was transcribed using iScript RT Super Mix (BioRad) following the manufacturer’s instructions. Q-RT-PCR was performed in triplicate on ABI PRISM 7900HT thermal cycler (Life Technologies) with SYBR green dye. The mRNA expression levels of the AXIN2 and LGR5 genes were normalised to TBP, SDHA and HPRT genes expression. The sequences of the primers (IDT) used for gene expression analyses were: AXIN2 FW 5′-CGGGCATCTCCGGATTC-3′; AXIN2 REV 5′- TCTCCAGGAAAGTTCGGAACA -3′; LGR5 FW 5′-CAAGCCATGACCTTGGCCCTG-3′; LGR5 REV, 5′-TTTCCCAGGGAGTGGATTCTATT -3; HPRT FW 5′-TCAGGCAGTATAATCCAAAGATGGT-3′; HPRT REV 5′-AGTCTGGCTTATATCCAACACTTCG-3′; SDHA FW 5′- TGGGAACAAGAGGGCATCTG-3′; SDHA REV 5′- CCACCACTGCATCAAATTCATG-3′; TBP FW 5′- CACGAACCACGGCACTGATT -3′; TBP REV 5′- TTTTCTTGCTGCCAGTCTGGAC -3′.
Abi prism 7900ht thermal cycler
Manufactured by Thermo Fisher Scientific
Sourced in Australia, United States
The ABI Prism 7900HT Thermal Cycler is a laboratory instrument designed for performing polymerase chain reaction (PCR) experiments. It is capable of precisely controlling temperature and time during the thermal cycling process, which is essential for the amplification of DNA samples.
Automatically generated - may contain errors
Lab products found in correlation
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (3 mentions)
Abi prism sequence detection software version 2, by Thermo Fisher Scientific (2 mentions)
Taqman gene expression master mix, by Thermo Fisher Scientific (2 mentions)
Transcriptor first strand cdna synthesis kit, by Roche (2 mentions)
Taqman fast advanced master mix, by Thermo Fisher Scientific (2 mentions)
Trizol, by Thermo Fisher Scientific (2 mentions)
Iscript rt supermix, by Bio-Rad (1 mentions)
Maxwell rsc mirna tissue kit, by Promega (1 mentions)
Nanodrop 1000, by Agilent Technologies (1 mentions)
2100 bioanalyser, by Agilent Technologies (1 mentions)
Truseq rna sample preparation kit version 2, by Illumina (1 mentions)
Taqman advanced mirna cdna synthesis kit, by Thermo Fisher Scientific (1 mentions)
Powerup sybr green master mix, by Thermo Fisher Scientific (1 mentions)
Primescript 1st strand cdna synthesis kit, by Takara Bio (1 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
Taqman gene expression assay, by Thermo Fisher Scientific (1 mentions)
Taqman gene expression master mix 2x, by Thermo Fisher Scientific (1 mentions)
Rna stat 60 reagent, by Tel-Test (1 mentions)
Sybr green pcr master mix, by Thermo Fisher Scientific (1 mentions)
9 protocols using abi prism 7900ht thermal cycler
1
Quantification of Colorectal Cancer Markers
2
Xenopus Animal Cap RNA-seq and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was generated from animal caps isolated at stage 10 from embryos that were injected at the two-cell stage with RNAs, targeting all four animal quadrants. Animal caps were cultured in 0.5× MMR, treated with 1 μM DEX at stage 11 to induce Multicilin-HGR, and harvested at 9 h (through stage 18) with the proteinase K method followed by phenol-chloroform extractions, lithium precipitation, and treatment with RNase-free DNase and a second series of phenol-chloroform extractions and ethanol precipitation. RNA-seq libraries were constructed with Illumina TruSeq RNA sample preparation kit version 2 according to the manufacturer’s instructions and sequenced on a HiSeq 2000 or 2500 at 1 × 50 or 1 × 100 base pairs to a depth of 20 million to 40 million reads. Each RNA-seq condition was performed in triplicate using animal caps isolated from different females.
RNA samples as prepared above were also used to measure gene expression using quantitative PCR as described previously (Stubbs et al. 2012 (link)). Briefly, RNA was converted in cDNA using reverse transcription and then assayed by quantitative PCR using the appropriate primer pairs (Supplemental Table 7) in triplicate with the ABI Prism 7900HT thermal cycler (Life Technology). Samples were normalized to the levels of ornithine decarboxylase (odc) RNA as an internal control.
RNA samples as prepared above were also used to measure gene expression using quantitative PCR as described previously (Stubbs et al. 2012 (link)). Briefly, RNA was converted in cDNA using reverse transcription and then assayed by quantitative PCR using the appropriate primer pairs (Supplemental Table 7) in triplicate with the ABI Prism 7900HT thermal cycler (Life Technology). Samples were normalized to the levels of ornithine decarboxylase (odc) RNA as an internal control.
3
qRT-PCR Analysis of Gene and miRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Complementary DNA (cDNA) was synthesized by a High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA, USA) for mRNA analysis. cDNA from miRNAs was obtained using a TaqMan™ Advanced miRNA cDNA Synthesis Kit (Applied Biosystems). Analysis of gene expression (Acaca, Adipor2, Cd36, Fasn, Ppargc1a, Scd1) was performed with the corresponding primers using PowerUp™ SYBR® Green Master Mix (Applied Biosystems). Analysis of Ccl2 and miRNA expression (let-7d-5p, miR-15b-5p, miR-22-3p, miR-26b-5p, miR-27b-3p, miR-34a-5p, miR-122-5p, miR-146b-5p, miR-149-5p, miR-181b-5p, miR-192-5p, miR-194-5p and miR-375-3p) was performed with TaqMan probes for the corresponding genes using TaqMan™ Fast Advanced Master Mix (Applied Biosystems). All RT-qPCR experiments were performed in an ABI Prism 7900HT Thermal Cycler (Applied Biosystems). The relative abundance of mRNAs or miRNAs was calculated using an endogenous reference gene (Gapdh for conventional TaqMan®, miR-191-5p for TaqMan® from miRNAs, miR-16-5p for TaqMan® from miRNAs of EVs, and Actb for SYBR®). SYBR Green primer sequences and TaqMan probes are shown in Tables S1 and S2 , respectively. The results were calculated using the 2−ΔΔCq method.
4
Quantifying Osteogenic Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The expression levels of osteogenesis-related genes including ALP, runt-related transcription factor 2 (Runx2), osteocalcin (OCN), and type I collagen (COL-1) were measured using qRT-PCR. The total RNA was extracted from the hBMSCs after culturing for 7 days by TRIzol reagent (Life Technologies) and RNA Kit (TransGen Biotech, Beijing, People’s Republic of China). Then TakaRa Prime-Script 1st strand cDNA Synthesis Kit (6110A) was used for cDNA synthesis. Complementary DNA was synthesized using 1 μg RNA following the manufacturer’s instructions. The qRT-PCR analysis was performed using ABI Prism 7900HT Thermal Cycler (Applied Biosystems Pty Ltd, Scoresby, VIC, Australia) using SYBR Green detection reagent. The relative expression of the genes was normalized against the housekeeping gene β-actin. The primer sequences for the target genes are listed in Table 1 . All samples were measured in triplicate.
5
Relative gene expression analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
c-Fos (Hs99999140-m1), CTNNB1/β catenin (Hs003550489-m1) and, as endogenous control, GAPDH (Hs00266705-g1) TaqMan Gene Expression Assays (Applied Biosystems, Foster City, CA) were used. Total RNA (1 μg) was reverse transcribed with oligo d (t) using a Transcriptor First Strand cDNA Synthesis Kit (Roche, Penzberg, Germany). Preliminary experiments were conducted for the endogenous control using the Ct slope method to ensure that the quality of each complementary DNA and the dynamic range of amplifications were comparable [44 (link)]. Real-time PCR was then carried out with 20 ng input complementary DNA, 1 × TaqMan Gene Expression Master Mix and TaqMan Gene Expression Assays on a ABI PRISM 7900 HT thermal cycler (Applied Biosystems). Data were analyzed using ABI PRISM Sequence Detection Software version 2.2.2 (Applied Biosystems). Relative expression was determined on triplicate reactions using the formula 2−ΔCt, reflecting target gene expression normalized to endogenous control levels [44 (link)].
6
Quantitative PCR Analysis of Melanoma Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from melanoma cell lines by TRIzol (Thermo Fisher Scientific) and cDNA was synthesized from 1 μg of RNA using Transcriptor First Strand cDNA synthesis Kit (Roche, Basel, Switzerland), according to the manufacturer instructions. qPCR was carried out using Taqman Gene Expression Assays 20X (Thermo Fisher Scientific, listed in Supplementary Table S4 ) and TaqMan Gene Expression Master Mix 2X (Applied Biosystems, Foster City, CA, USA). qPCR was carried out with 20 ng input complementary DNA, 1 × TaqMan Gene Expression Master Mix and TaqMan Gene Expression Assays on an ABI PRISM 7900 HT thermal cycler (Applied Biosystems). Data were analyzed using ABI PRISM Sequence Detection Software version 2.2.2 (Applied Biosystems). Relative expression was determined using the formula 2−ΔCt, reflecting target gene expression normalized to endogenous control genes levels [10 (link)].
7
Real-time qPCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from iBAT, posterior subcutaneous AT and MEFs using RNA STAT-60 reagent (TEL-TEST). 2 μg of total RNA were reverse transcribed with High Capacity cDNA Reverse Transcription Kit (Applied Biosystems). Real-time PCR was performed on ABI Prism® 7900 HT thermalcycler (Applied Biosystems) using SYBR® Green PCR Master Mix (Applied Biosystems) as reported [5] (link). Individual mRNA levels were normalized to 36B4 and expressed as fold-change relative to non-differentiated Agpat2+/+ MEFs or wild type mice AT, with the ΔΔCt method. Primer sequences used for real time PCR are provided in Supplementary Table 1 .
8
Quantitative Analysis of miRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Complementary DNA (cDNA) was synthesized by a High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA, USA) for mRNA analysis. Quantitative polymerase chain reaction (qPCR) was done using cDNA as template and the TaqMan® Fast Advanced Master Mix (Thermo Scientific, Waltham, MA, USA). The genes were detected using TaqMan® (Thermo Scientific, Waltham, MA, USA) probes for hsa-miR-143-3p (477912_mir, mature miRNA sequence: UGAGAUGAAGCACUGUAGCUC), mmu-miR-155-5p (mmu480953_mir, mature miRNA sequence: UUAAUGCUAAUUGUGAUAGGGGU) and mmu-miR-191-5p (mmu481584_mir, mature miRNA sequence: CAACGGAAUCCCAAAAGCAGCUG) used as endogenous gene. The references of other Taq-Man® probes used are indicated in the Supplemental Table S2 . All the probes detect both mouse and human target genes. All RT-qPCR experiments were performed in an ABI Prism 7900HT Thermal Cycler (Applied Biosystems, Foster City, CA, USA).
The relative abundance of mRNA targets, normalized with the endogenous gene and relative to the control, is calculated as follow a: Relative Quantification (RQ) = 2−ΔΔCt; ΔCt (cycle threshold) = Ct (miRNA target) − Ct (miR-191-5p); ΔΔCt = ΔCt for any sample − ΔCt for the control]. Amplification of miR-191-5p was used in the same reaction of all samples as an internal control.
The relative abundance of mRNA targets, normalized with the endogenous gene and relative to the control, is calculated as follow a: Relative Quantification (RQ) = 2−ΔΔCt; ΔCt (cycle threshold) = Ct (miRNA target) − Ct (miR-191-5p); ΔΔCt = ΔCt for any sample − ΔCt for the control]. Amplification of miR-191-5p was used in the same reaction of all samples as an internal control.
9
Immune Transcripts Profiling in Ocular Swabs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Analysis of ocular swab cDNA was performed using TLDA Microfluidic Cards (Applied Biosystems) according to the manufacturer's instructions. Custom array cards were used to interrogate expression profiles of immune transcripts (Supplementary Table 1 ). Arrays were run on an ABI PRISM® 7900HT thermal cycler (Applied Biosystems) using SDS software. Cycling conditions were as follows: 2 min at 50°C | 10 min at 94.5°C | 40 cycles (30 s at 97°C | 1 min at 59.7°C). Data were collected at 97 and 59.7°C. Cycle threshold (CT) was set to a standard mid-exponential phase amplification point. Delta CT values relative to housekeeping genes (GAPDH and HPRT1) were calculated using R (R: A language and environment for statistical computing. R Foundation for Statistical Computing, Vienna, Austria; https://www.R-project.org ). Genes and individuals with ≥10% missing data were excluded. Fold-change was calculated using the delta-delta CT method. Modules of co-expressed genes were identified using the Weighted Correlation Network Analysis (WGCNA) package and putative functions were assigned manually based on known functions of genes in each module (Langfelder and Horvath, 2008 (link), 2012 (link)). All genes in each module were included in a principal component analysis (PCA), the first component of which was used as an expression score per individual for each module.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!