Opti minimum essential medium

Manufactured by Thermo Fisher Scientific

Sourced in United States, United Kingdom

Opti-Minimum Essential Medium is a cell culture medium formulation developed by Thermo Fisher Scientific. It is optimized to provide a balanced nutrient environment for the growth and maintenance of various cell lines in vitro.

Automatically generated - may contain errors

Lab products found in correlation

Spelling variants of this product

OPTI-medium (29 citations)

13 protocols using opti minimum essential medium

Investigating T Cell Activation Pathways

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total spleen cells were isolated from spleen of C57B/L6 male mice [24 (link)], naïve CD4⁺ T cells and CD4⁺ T cells were purified from splenocytes through magnetic separation technology. C57B/L6 mice (male, 20–22 g, 8 weeks) were purchased from Shanghai Jiagan Biotechnology Co., Ltd. (Shanghai, China); NEO (>97.7% purity verified by HPLC) was purchased from SiChuan RuiFenSi Medical Technology Co. (SiChuan, China). Naïve CD4⁺ T cells isolation kits were purchased from Miltenyi Biotec (Bergisch Gladbach, Germany). Primary antibodies, including p-STAT3(Tyr705), p-STAT4(Y693), p-STAT5(Y694), p-STAT6(Y641) and STAT3, STAT4, STAT5 and STAT6 were purchased from Cell Signaling Technology (Boston, USA); β-actin was obtained from Santa Cruz Biotechnology (Santa Cruz, CA, USA). CD3, CD4, CD8, CD25, CD69, Foxp3, RORγt, IL-17A antibody and CFSE label-probe were obtained from BD Biosciences (San Jose, CA, USA). Lipofectamine 3000 kits were provided by Invitrogen (Carlsbad, CA, USA); RPMI 1640 Medium, OPTI-Minimum Essential Medium (MEM), Fetal bovine serum (FBS), Fetal bovine serum (FBS) and 100 × penicillin-streptomycin (P/S) were purchased from Gibco (Paisley, UK). Phosphate Buffered Saline (PBS) were obtained from Invitrogen (Carlsbad, CA, USA). Cholecystokinin octapeptide (CCK8) and Dimethylsulfoxide (DMSO) were purchased from Sigma Aldrich (St. Louis, MI, USA).

Chen J.Y., Yang Y.J., Ma X.Q., Cao Q., Wei S.S., Pan R.R., Nan L.H., Liu Y.J., Cao Y., Tian X.Y., Deng S., Cheng Z.X., Wang C.J., Chen T., Zheng Y.F, & Huang M.Q. (2022). Neobaicalein Inhibits Th17 Cell Differentiation Resulting in Recovery of Th17/Treg Ratio through Blocking STAT3 Signaling Activation. Molecules, 28(1), 18.

+ Open protocol

+ Expand

Fetal Bovine Serum Cell Culturing Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Fetal bovine serum (FBS) was purchased from Hyclone (Logan, UT, USA). Opti Minimum Essential Medium (MEM) and Roswell Park Memorial Institute (RPMI) 1640 media were purchased from Gibco (Grand Island, NY, USA). Lipofectamine 2000 was from Invitrogen (Carlsbad, CA, USA). 0.5 g MTT was dissolved in 100 mL PBS, filtered through a 0.22-mm membrane, and stored in the dark at 4°C. The anti-miR-1 (miR-1 antisense oligonucleotide) and a nonspecific anti-miR control were purchased from GenePharma (Shanghai, China). miR-1 primers were synthesized by Sangon Biotech Co. Ltd. (Shanghai, China).

Wang Y.Q., Cai Y, & Zhong X.M. (2017). Suppression of the biological activity of neuroglioma cells by down-regulation of miR-1. Genetics and molecular research : GMR, 16(3).

+ Open protocol

+ Expand

In vivo Experiments Using C57BL/6 Mice

Check if the same lab product or an alternative is used in the 5 most similar protocols

The FDA-approved drug library (L1300) and regorafenib were purchased from Selleckchem (Houston, TX). Porcine pancreatic elastase (PPE) was obtained from Elastin Products Company, Inc. (Owensville, MO). Invivofectamine 3.0, Lipofectamine 3000, RNAiMAX, fetal bovine serum (FBS), and Opti-Minimum Essential Medium (MEM) were purchased from Thermo Fisher Scientific, Inc. (Waltham, MA). PCR primers and siRNAs were obtained from Bioneer (Daejeon, Korea) and Thermo Fisher Scientific, Inc., and a list of their sequences is provided in the supplementary materials. A summary of the primary and secondary antibodies used is provided in the supplementary materials. Male C57BL/6 mice were obtained from Daehan Bio Link (DBL) (Chungbuk, Korea). Animals received sufficient food and water. All experimental protocols were approved by the Chungbuk National University Animal Care and Use Committee^{33 (link)}. Detailed information regarding the materials used in this study is provided in the supplementary materials.

Park J.J., Oh K., Lee G.W., Bang G., Park J.H., Kim H.B., Kim J.Y., Shin E.Y, & Kim E.G. (2023). Defining regorafenib as a senomorphic drug: therapeutic potential in the age-related lung disease emphysema. Experimental & Molecular Medicine, 55(4), 794-805.

+ Open protocol

+ Expand

miR-21 mimic and inhibitor transfection

Check if the same lab product or an alternative is used in the 5 most similar protocols

HeLa cells were conventionally cultured in DMEM containing 10% fetal bovine serum. The third generation of cells were collected, counted and seeded at a density of 10×104 cells/well and cultured for 18 h before transfection. miR-21 mimic (forward, UAGCUUAUCAGACUGAUGUUGA and reverse, AACAUCAGUCUGAUAAGCUAUU), miR-21 inhibitor (UCAACAUCAGUCUGAUAAGCUA) and negative control (forward, UUCUCCGAACGUGUCACGUTT and reverse, ACGUGACACGUUCGGAGAATT for miR-21 mimic; CAGUACUUUUGUGUAGUACAA for miR-21 inhibitor) (Dharmacon; GE Healthcare Life Sciences, Little Chalfont, UK) were diluted with 50 µl Opti-minimum essential medium (MEM; Thermo Fisher Scientific, Inc.) to a final concentration of 100 nM. Liposome (2 µl) was added to 50 µl Opti-MEM. A total of 5 min later, the two diluted liquids were mixed and incubated at room temperature for 30 min, and then added to the culture media. The culture media was replaced 4 h later. Each experiment was repeated three times.

Xu L., Xu Q., Li X, & Zhang X. (2017). MicroRNA-21 regulates the proliferation and apoptosis of cervical cancer cells via tumor necrosis factor-α. Molecular Medicine Reports, 16(4), 4659-4663.

+ Open protocol

+ Expand

Visualizing CD44-Mediated Nanoparticle Uptake

Check if the same lab product or an alternative is used in the 5 most similar protocols

The THP1 cell line was maintained in RPMI 1640 medium supplemented with 10% FBS and 2 mmol/L L-glutamine. Cells were seeded 0.5×10⁶ per chamber of Nunc^™ Lab-Tek^™ II Chamber Slide^™ System (Cat# 154534, Thermo Fisher Scientific). THP1 cells were differentiated using 200 nM phorbol 12-myristate 13-acetate (Cat# 1585, Sigma-Aldrich) for 2 days. After the initial 2 days, cells were washed with PBS and cultured in fresh RPMI 1640 (10% FBS, 1% L-glutamine) for one additional day. On the day of experiment, cells were washed with PBS and CD44 antibody (Cat# MU310, BioGenex Laboratories) was added at 1:100 dilution in Opti-Minimum Essential Medium (MEM) (Thermo Fischer Scientific) for 30 min at 4°C. HA-coated NP was added to the cells at 1:100 ratio (v/v) and the cells were cultured for 26 hours at 37°C, washed with PBS and fixed with 2% PFA for 1 hour. The cells were mounted with VECTASHIELD mounting medium with DAPI. The images were captured by a Leica DM 2000 microscope with a Leica DMC 4500 color camera and analyzed with Leica Application Suite (LAS) X software.

Yan H., Hu Y., Akk A., Wickline S.A., Pan H, & Pham C.T. (2022). Peptide-siRNA nanoparticles targeting NF-κB p50 mitigate experimental abdominal aortic aneurysm progression and rupture. Biomaterials advances, 139, 213009.

+ Open protocol

+ Expand

Comparative Analysis of Prostate Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols

Human prostate cancer cell lines from brain metastatic DU145, bone metastatic PC3, lymph metastatic LNCaP, and non-malignant prostate epithelial cell line PWR-1E were purchased from American Type Culture Collection (Manassas, VA). DuPro cells derived from PC3 were also utilized [20 (link)] and obtained from collaborator Dr. R. Dahiya. Keratinocyte serum-free medium, bovine pituitary extract and human recombinant epidermal growth factor were purchased from Invitrogen (Carlsbad, CA). RPMI 1640, Opti-minimum essential medium and penicillin/streptomycin were obtained from Thermo Fisher Scientific, (Waltham, MA). Fetal bovine serum (FBS) was a product of Atlanta Biologicals (Lawrenceville, GA).

Hashimoto Y., Shiina M., Maekawa S., Kato T., Shahryari V., Kulkarni P., Dasgupta P., Yamamura S., Saini S., Tabatabai Z.L., Dahiya R, & Tanaka Y. (2021). Suppressor effect of catechol-O-methyltransferase gene in prostate cancer. PLoS ONE, 16(9), e0253877.

+ Open protocol

+ Expand

Cell Culture Protocols for HEK293, ARPE-19, and N2A

Check if the same lab product or an alternative is used in the 5 most similar protocols

HEK293 (#CRL-1573), HEK293T (#CRL-3216), ARPE-19 (#CRL-2302), and N2A (#CCL-131) cells were purchased from American Type Culture Collection (Manassas, VA). Cells were cultured in Dulbecco’s modified Eagle's medium (DMEM, Thermo Fisher Scientific, Waltham, USA), Dulbecco’s Modified Eagle Medium/Nutrient Mixture F-12 (DMEM-F12, Thermo Fisher Scientific, Waltham, MA, USA), and opti-Minimum Essential Medium (Thermo Fisher Scientific, Waltham, MA, USA), respectively, supplemented with 10% fetal bovine serum (FBS, Thermo Fisher Scientific, Waltham, MA, USA), 100 U/mL penicillin (Thermo Fisher Scientific, Waltham, MA, USA), and 100 μg/mL streptomycin (1% P/S, Thermo Fisher Scientific, Waltham, MA, USA). Cells were maintained in an incubator at 37°C and 5% CO₂ atmosphere.

Tian X., Zheng Q., Xie J., Zhou Q., Liang L., Xu G., Chen H., Ling C, & Lu D. (2023). Improved gene therapy for MFRP deficiency-mediated retinal degeneration by knocking down endogenous bicistronic Mfrp and Ctrp5 transcript. Molecular Therapy. Nucleic Acids, 32, 843-856.

+ Open protocol

+ Expand

Manipulation of Keap1 and Nrf2 Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

ACHN cells were seeded in a 6-well plate (1×10⁵) for 24 h prior to transfection. Small interfering (si)Keap1, siNrf2, overexpressing Keap1, overexpressing Nrf2 and empty control plasmids were purchased from Shanghai GeneChem Co., Ltd. (Shanghai, China). The sequence of siKeap1 was 5′-GAA TGA TCA CAG CAA TGA A-3′; the sequence of siNrf2 was 5′-GGT TGC CCA CAT TCC CAA ATC-3′; the sequence for overexpressing Keap1 was 5′-ATA CTC GAG ATG CAG CCA GAT CCC AGG CC-3′; the sequence for overexpressing Nrf2 was 5′-GTA CTA GTA TGA TGG ACT TGG AGT T-3′; and the NC sequence was 5′-GTT CTC CGA ACG TGT CAC GT-3′. Lipofectamine^® 2000 (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA) was used to perform the transient transfection, according to the manufacturer′s protocol. In total, 2 µg si/overexpressing RNA, negative control (NC) and Lipofectamine^® 2000 were added to Opti-Minimum Essential Medium (Gibco; Thermo Fisher Scientific, Inc.) and incubated at 25°C for 20 min. Lipofectamine^® 2000 was subsequently mixed into each well, which was cultured in Opti-MEM RPMI 1640. After 6 h of culturing, the fluid was replaced with RPMI 1640 medium containing 10% FBS.

Huang H., Wu Y., Fu W., Wang X., Zhou L., Xu X., Huang F, & Wu Y. (2019). Downregulation of Keap1 contributes to poor prognosis and Axitinib resistance of renal cell carcinoma via upregulation of Nrf2 expression. International Journal of Molecular Medicine, 43(5), 2044-2054.

+ Open protocol

+ Expand

Silencing FGF9 and PDGFRβ in VSMCs

Check if the same lab product or an alternative is used in the 5 most similar protocols

Specific siRNA sequences against FGF9 and PDGFRβ were synthesized by Tsingke (Guangzhou, China; sequences of siRNAs are available in Supplementary Table 3). Primary VSMCs were seeded in 6-well plates and cultured for 24 hours. The cells were then starved with DMEM without FBS or penicillin/streptomycin. Then, 50 nmol/L siRNA and Lipofectamine 3000 (L3000015, Invitrogen) were added to two Eppendorf tubes with 250 µL of Opti-Minimum Essential Medium (Gibco BRL, Paisley, United Kingdom). Then, the solutions in the two tubes were mixed and incubated at room temperature for 20 minutes and added to the cells. After a 6-hour incubation, the medium was replaced with DMEM supplemented with FBS. The cells were finally subjected to RNA isolation, protein isolation or coculture experiments.

Xie J., Tang Z., Chen Q., Jia X., Li C., Jin M., Wei G., Zheng H., Li X., Chen Y., Liao W., Liao Y., Bin J, & Huang S. (2023). Clearance of Stress-Induced Premature Senescent Cells Alleviates the Formation of Abdominal Aortic Aneurysms. Aging and Disease, 14(5), 1778-1798.

+ Open protocol

+ Expand

HMGB1 Secretion Analysis in SARS-CoV-2 Infection

Check if the same lab product or an alternative is used in the 5 most similar protocols

To analyze HMGB1 secretion in the supernatants, culture media were replaced with serum-free Opti-minimum essential medium (Gibco^®, Grand Island, NY, USA). Cells were pre-treated with or without 1 µM or 5 µM GSK-872 for 24 h, and 10 µM or 50 µM Z-IETD-fmk for 1 h. Cells with inhibitors were infected with SARS-CoV-2 at an 0.1 MOI for 48 h, and cells without inhibitors were infected with SARS-CoV-2 at 0.1 MOI for 6, 24, and 48 h. The culture supernatants were harvested and concentrated via methanol precipitation after removing the cell debris. Ice-cold methanol and chloroform were added to the culture supernatants, and the mixture was centrifuged at 2,000 × g for 10 min. The upper area above the protein layer was quickly removed, methanol was added at a ratio of a quarter of the supernatant, and then centrifuged at 20,000 × g for 10 min at 4°C. Supernatants were removed, and protein sample buffer was added to the protein pellet, followed by heating at 95°C for 10 min. Western blot analysis was performed using anti-HMGB1 Ab (Abcam).

Kwak M.S., Choi S., Kim J., Lee H., Park I.H., Oh J., Mai D.N., Cho N.H., Nam K.T, & Shin J.S. (2023). SARS-CoV-2 Infection Induces HMGB1 Secretion Through Post-Translational Modification and PANoptosis. Immune Network, 23(3), e26.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!