Plant rna isolation kit

Total RNA from four treatments (0 h, 6 h, 12 h and 24 h) seedlings (Among them, 0h treatment was considered as the control check group (CK group)) with three biological replicates for each treatment was extracted using the Plant RNA Isolation Kit (Tiangen, Beijing, China). Sequencing library were constructed using RNA Library Prep Kit for Illumina (NEB, Boston, MA, USA). Then the libraries were sequenced using a Hiseq 4000 (Illumina, San Diego, CA, USA), and generated 150 bp paired-end reads. To get clean reads, sequences with length less than 30 bp, reads with N ratio over 10% and without inserted fragments due to reasons such as connector self-connection and adapter sequences were removed using SeqPrep (https://github.com/jstjohn/SeqPrep) and Sickle (https://github.com/najoshi/sickle) [18 (link)]

Total RNA was isolated from different organs using a plant RNA isolation kit (Tiangen). The RNA sample (3 μg) was used for complementary DNA synthesis with the SuperScript III (Invitrogen) according to the manufacturer's instructions. RT–PCR was performed with Taq Master Mix (CWBIO) using ACTIN7 as a control. Quantitative real-time RT–PCR analysis was performed with the Bio-Rad CFX96 real-time PCR detection system using the LightCycler 480 SYBR Green Master Mix (Roche). ACTIN2, TUB2, UBQ10, GAPDH or EF1A mRNAs were used as internal controls. Relative amounts of mRNA were calculated using the Cycle threshold (Ct) method. Ct values correspond to the cycle number at which the fluorescence resulting from enrichment of the PCR product reaches significant levels above the background fluorescence. The ΔCt was determined by subtracting the Ct values of ACTIN2, TUB2, UBQ10, GAPDH or EF1A from the SAP Ct value. The ratios were calculated as being equal to 2^−ΔCt. PCR reactions were performed in triplicate for each sample. The primers used for RT–PCR and quantitative real-time RT–PCR are listed in Supplementary Table 2.

The total RNA of 2‐week grain filling seeds was isolated using the plant RNA isolation kit (TIANGEN Biotech, Beijing). Briefly, 1 μg of RNA was treated with DNase and reverse‐transcribed according to the manufacturer’s protocol (EasyScript^®; TransGen Biotech, Beijing). qRT‐PCR was performed using SYBR Green RT‐PCR Master Mix (Qiagen, Duesseldorf, Germany). Two Actin genes were used as an internal control for the quantification of gene expression, amplified by the primers PB140 (ACCCAGATCATGTTCGAGACC) and PB141 (TTCGACCGCTGGCATACAAA) for Actin‐1D (TraesCS1D01G274400) and PB142 (GCCGTTCTGTCCTTGTATGC) + PB143 (GAGGAAGCGTGTATCCCTCA) for Actin‐1B (TraesCS1B01G283900). TraesCS2B01G459900.1 was amplified using the primers PB136 (GACAGGCGCATTCTTGACG) and PB137 (CAGCTCCTCCACGATGAACA). The relative gene expression was calculated as reported by Schroeder et al. (2018). Specific primers were designed with the assistance of the Primerserve program (Triticeae Multi‐omics Center).