The lentiCRISPRv2 vector targeting RIPK1 (sgRNA, 5’- CTCGGGCGCCATGTAGTAGA-3’) was constructed by the Azenta company. HEK 293 T cells were transfected with lentiCRISPRv2 targeting RIPK1 and empty vector using Hieff TransTM Liposomal Transfection Reagent (Yeasen), respectively. The viruses were collected at 24 h and 48 h, respectively, filtered with a 0.45 mm filter head, and then added to the virus concentrate and treated at 4 °C overnight. The concentrated viruses were added to HT29 cells along with 8 μg/mL of polybrene (Yeasen) to enhance transfection efficiency. The infection assay was repeated in the next day under the same conditions. Finally, HT29 cells were screened with 3 μg/mL puromycin. Western blot analysis was used to confirm the RIPK1 deletion.
Polybrene
Manufactured by Yeasen
Sourced in China
Polybrene is a cationic polymer that is commonly used as a transfection reagent in cell culture experiments. It functions by facilitating the uptake of nucleic acids, such as DNA or RNA, into cells by promoting the interaction between the negatively charged nucleic acids and the positively charged cell membrane.
Automatically generated - may contain errors
Lab products found in correlation
Lipofectamine 2000, by Thermo Fisher Scientific (8 mentions)
Fetal bovine serum (fbs), by Thermo Fisher Scientific (7 mentions)
Puromycin, by Yeasen (6 mentions)
Puromycin, by Beyotime (5 mentions)
Polyethylenimine (pei), by Polysciences (4 mentions)
Lipofectamine 3000, by Thermo Fisher Scientific (4 mentions)
Penicillin streptomycin, by Thermo Fisher Scientific (4 mentions)
Dulbecco modified eagle medium (dmem), by Thermo Fisher Scientific (3 mentions)
Co2 incubator, by Thermo Fisher Scientific (3 mentions)
Streptomycin, by Thermo Fisher Scientific (2 mentions)
Pspax2, by Addgene (2 mentions)
Pmd2 g, by Addgene (2 mentions)
Puromycin, by Solarbio (2 mentions)
Human cd3 cd28 beads, by Thermo Fisher Scientific (2 mentions)
Hek293t, by American Type Culture Collection (2 mentions)
Puromycin, by Thermo Fisher Scientific (2 mentions)
Alexa fluor 488, by Thermo Fisher Scientific (2 mentions)
Dimethyl sulfoxide (dmso), by Merck Group (2 mentions)
Turbofect, by Thermo Fisher Scientific (2 mentions)
Hieff trans liposomal transfection reagent, by Yeasen (1 mentions)
54 protocols using polybrene
1
Efficient RIPK1 Knockdown in HT29 Cells
2
Retroviral Transduction of Mouse CD4 T Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The SIGIRR cDNA was PCR amplified and cloned into pMIG (SIGIRR-IRES-GFP). Phoenix helper-free retrovirus producer lines (Ivanov et al. 2006 (link); Schraml et al. 2009 (link)) were transfected with 10 μg of the indicated plasmids using polyethylenimine (Polysciences). The viral supernatant was collected and supplemented with 5 mg/ml polybrene (Yeasen). For viral transduction, sorted mouse CD4 T cells were plated, fresh retrovirus supernatant was added, and the cells were spun at 2500 rpm for 1.5 h at 30 °C. After spin infection, the cells were cultured in T cell culture medium and harvested on day 3 for intracellular cytokine staining and quantitative real-time PCR analysis.
3
Optimizing ADSC Transduction Efficiency
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were grown to 70-80% confluence, and Ad-SK4 in transduction enhancer Polybrene (Yeasen) was added to ADSCs at different multiplicity of infection (MOI) values (0, 20, 50, 100, 150 and 300). Polybrene was added at the same concentration for 4 h for different MOI values. The control group was transduced with Ad-GFP. The medium was replaced after 4 h. Cells were observed using light and fluorescence microscopy (BX51 systems, Olympus Corporation). ADSCs with different MOI values were digested with 0.25% trypsin at 48 h after transduction. The cell suspension was washed twice with phosphate-buffered saline (PBS). Non-transduced cells served as a negative control. The percentage of GFP-positive cells was detected using flow cytometric analysis (Becton, Dickinson and Company).
4
FGFR1 Mutant Overexpression and Knockdown
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Full-length FGFR1 and truncated mutants were amplified by PCR and subcloned into the p3XFLAG-CMV vector. pLKO.1-FGFR1-shRNA1, pLKO.1-FGFR1-shRNA2, and Plko.1-FGFR1-shRNA3 were generated by GenScript Biotech Inc. (Hangzhou, China). HEK293T cells were transfected with the psPX2 and pMD2. G plasmids to obtain lentiviruses. The medium was replaced 24 h after transfection, and the conditioned medium containing virus particles was collected 48 h and 72 h after transfection. For virus infection, cells were treated with 10 μg/mL polybrene (Yeasen, China) mixed with virus-containing medium and culture medium at a ratio of 1:1 for 24 h. The cells were transfected again for 24 h, cultured in fresh medium for 24 h, and selected with puromycin-containing medium for 1 week. The sequences of the specific shRNAs used in this study are as follows: shFGFR1#1 (5′GATCCGGCTTCACTTAAGAATGTCTCTCAAGAGAGACATTTCTTAAGTGAAGCTTTTT3′), shFGFR1#2 (5′GATCCGCCGTCAATGTTTCAGATGATGCTATCAAGAGGAGCATCTGAAACATTGACGGTTTTT3′), and shFGFR1#3 (5′GATCCGGGCTTATTAATTCCGATACTATCAAGAGTAGTATCGGAATTAATAAGCCTTTTT3′).
5
VSIG4 and STAT1 RNAi in PDAC cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cell lines AsPC-1 and Capan1 were obtained from Cell Bank of the Chinese Academy of Sciences. All cell lines were maintained at 37 °C and 5% CO2. AsPC-1 cells were cultured in DMEM (Meilunbio, China) containing 10% fetal bovine serum (FBS) (Gibco; Life Technology) and 50 μg/mL penicillin/streptomycin (P/S). CAPAN1 cells were cultured in IMDM (BIOAGRIO) containing 20% FBS (Gibco; Life Technology) and 50 μg/mL penicillin/streptomycin (P/S). To interfere the expression of VSIG4 and STAT1 in cell lines, RNAiMAX reagent (Thermo Fisher, USA) mixed with small interference RNA targeting VSIG4 was applied according to the manufacturer’s instructions. Short hairpin RNAs specifically targeting VSIG4 cell lines were generated using lentiviral vectors. A total of 300,000 PDAC cells were infected with viral supernatants and 10 μg/mL polybrene (Yeasen) for 6 h. Transfected cells were selected with 10 μg/mL puromycin to produce stable cell lines.
6
Cardiomyocyte Hypertrophy and Proliferation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To investigate the effect of LEC-conditioned medium on cardiomyocytes, NRCMs were starved and then treated with either LEC-conditioned medium or control medium for 48 h. To examine whether AKT activation contributed to the effect of LEC-conditioned medium, NRCMs were treated with AKT inhibitor MK2206 (S1078; Selleck) at 10 nM during the first 24 h of treatment and then cultured with either control medium or LEC-conditioned medium for 48 h as described above. To examine the involvement of the C/EBPβ–CITED4 axis in the effect of LEC-conditioned medium, NRCMs were infected with C/EBPβ expression lentivirus using Polybrene (40804ES76; YEASEN, Shanghai, China) or transfected with CITED4 small interfering RNA using Lipofectamine 2000 (11668-019; ThermoFisher, Waltham, MA, USA) during the 48-h treatment of control medium or LEC-conditioned medium. At the end of treatment, total RNA was extracted from cardiomyocytes for reverse transcription quantitative polymerase chain reactions (RT-qPCRs), and immunofluorescent stainings for Ki67/α-Actinin or 5-ethynyl-2’-deoxyuridine (EdU)/α-Actinin were carried out to determine cardiomyocyte hypertrophy and proliferation.
7
CD34+ Cell Lentiviral Transduction
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The collected CD34+ cells were cultured with 2 × 105 cells per well in 24-well plate at 37 °C, in 5% CO2 for 2 days. Cells were collected by centrifuge and supernatant was discarded. In total, 200 μl viruses and 200 μl culture medium supplemented with 8 μg/ml polybrene (Yeasen, Cat: 40804ES86) were gently mixed with cell pellet and added into each well. The culture plates were spun at 2,500 rpm for 90 min at 25 °C, and then placed back to incubator. After 12 h’ incubation at 37 °C, in 5% CO2, medium was changed. Three days later, EGFP+ frequency was monitored by flow cytometry.
8
Culturing Diverse Breast Cancer Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human breast cancer cell lines (MDA-MB-231, BT-549, MCF-7, T47D, MDA-MB-453) and human embryonic kidney 293T (HEK-293T) cell lines were purchased from Cell Bank of Type Culture Collection of Chinese Academy of Sciences (Shanghai, China). All of the cells were cultured in a modified medium supplemented with 10% fetal bovine serum (FBS, 1600044, Gibco, MA), 100 U/mL penicillin, 100 mg/mL streptomycin (15140122, Gibco), and 1% GlutaMAX (35050061, Gibco). MDA-MB-231, MDA-MB-453, HEK-293T cells were specifically cultured in high-glucose DMEM (SH30243.01, Hyclone, UT), BT-549 cells in RPMI 1640 (SH30809.01, Hyclone), MCF-7 cells in DMEM/F12 (SH30023.01, Hyclone). The number of passages of all the cell lines did not exceed five. Cell transfection was performed using Hiff TransTM Liposomal Transfection Reagent (40802ES02, YEASEN, Shanghai, China). Cell infection was mediated by the use of polybrene (40804ES76, YEASEN).
9
Comprehensive Cell Autophagy Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
H2DCFDA, rapamycin, pyronin Y, and buthionine sulfoximine were obtained from Sigma-Aldrich Co. (USA). Bafilomycin A1 and pepstatin A were obtained from Sangon Biotech Co. (China). D-Luciferin was obtained from Goldbio Co. (USA). Polybrene, Hoechst 33342, and propidium iodide (PI) were obtained from Yeasen Biotech Co. (China). Transfection reagents DharmaFECT, Lipofectamine 2000, and Alexa Fluor 488 and 567 secondary antibodies were obtained from Thermo Fisher Scientific Inc. (USA, 1:500). Anti-LC3 (#3868, 1:1000), anti-Beclin (#3495, 1:1000), anti-ATG5 (#12994, 1:1000), anti-Oct-4 (#2750, 1:1000), and anti-p62/SQSTM1 (#7695, 1:1000) antibodies were obtained from Cell Signaling Technology (USA). Anti-RB1CC1 (sc-22709, 1:100), anti-Ki-67 (sc-23900, 1:100), and HRP-conjugated goat anti-rabbit secondary antibodies were obtained from Santa Cruz Biotechnology (USA). Anti-vimentin, HRP-conjugated goat anti-mouse, and rabbit anti-goat secondary antibodies were obtained from Boster Co. (China). Anti-β-tubulin (1:1000) and anti-β-actin (1:1000) antibodies were obtained from Transgene Biotech Co. (China). Anti-NRF2 (WL02135, 1:2000), anti-NOTCH1 (WL01991, 1:500), and anti-Lamin B (WL01775, 1:500) antibodies were obtained from Wanleibio Co. (China).
10
Isolation and Transduction of Primary T Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Splenocytes were harvested from the BALB/c mice. Primary CD3+ T cells, which included CD4+ T cells and CD8+ T cells, were purified from the splenocytes using the mouse CD3 T cell isolation kit (BioLegend) and were cultured at 106/mL in RPMI-1640 medium (HyClone) supplemented with 10% FBS (Gibco), HEPES (10 mM, Solarbio), sodium pyruvate (1 mM, GENOM), 1× non-essential amino acids (Gibco), β-mercaptoethanol (50 μM, Sigma) and 100 IU/mL penicillin and streptomycin (10 mg/mL, Gibco). T cells were stimulated under the condition of anti-mouse CD3 antibody (1 μg/mL, BioLegend) and anti-mouse CD28 antibody (2 μg/mL, BioLegend). 48 h after T cells stimulation, T cells were transduced with retroviral supernatants from the Plat-E cell line in the presence of polybrene (6 μg/mL, Yeasen) by centrifugal infection. T cells were analyzed by flow cytometry 2 days after transduction and were used for further experiments.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!