Lightcycle 96 real time pcr system

The RT-qPCR was performed using the SYBR®Green Premix Pro Taq HS qPCR Kit (No. AG11701, Accurate, China) in a Roche lightcycle®96 real-time PCR system (Roche, Germany), with 3 technical replicates. The qPCR volume was 20 μL in total, including 3 μL template cDNA, 1 μL forward primer and 1 μL reverse primer, 10 μL SYBR®Green Pro Taq HS Premix, and 5 μL RNase-free water. Six DEGs were selected for the validation of the transcript data. A housekeeper gene, A. roxburghii β-Actin, was used as the internal reference ^{21 (link)}, which provided a basis for the relative quantification assays. The two-step cycling qPCR method was used in our experiment. Briefly, the denaturation was 95 °C for 30s, following 62 °C, 30s of annealing for 40 cycles. All primers used in this assay are listed in Table 1.Table 1

Primers of DEGs for real-time fluorescent quantitative PCR.

Gene name	Forward primer (5′-3′)	Reverse primer (5′-3′)
HemH	AAAGCGGAGATGGAGGAGTG	ATTCCACAGGTCCAACTCGG
ChlM	CCAAGCAGCCCTATTCGTTC	CGAGCTGGACCTTATTGACG
GLU	AGGTGGGATGTCTTTGGGAG	CAAAACGCCCTGAAGCAACC
bHLH	CTCCATGCTCCTCTGATTG	ATGAGCACTATTTGTGGGTC
YABBY	CCAAGCCAGACATTCCTCAC	ACTTGGACCGCTACTGTTGG
LOB	ACGTGGCGAAACTCCTGAAC	TAGCCAACGCATCCGTAGAC
β-Actin	AGATGAGGCACAGTCCAAGA	GCTGGAACATTGAAGGTCTC

The RNA samples (1 μg) with A260/A230 ratios between 1.8 and 2.2 were used to synthesize the first strand of cDNA with the First Strand cDNA Synthesis Kit (CISTRO, Guangzhou, China) in a 20 μL reaction mixture according to the manufacturer’s protocol. The cDNA samples were diluted 10-fold with distilled water prior to the qRT-PCR analysis. The qRT-PCR analysis was performed using ChamQ Universal SYBR qPCR Master Mix (Vazyme, Nanjing, China) and Roche Light Cycle96 Real-Time PCR system with the following reaction conditions: initial denaturation at 95 °C for 30 s, followed by a two-step program of 95 °C for 10 s and 60 °C for 30 s for 40 cycles, with a melting curve analysis at 95 °C for 15 s, then from 60 °C to 95 °C at a rate of 0.2 °C/s. Candidate genes related to phillyrin were identified from F. suspensa transcriptome data, the longest CDS sequence was selected, and the specific primers for the target genes were designed using Oligo 7.0, and are listed in Table S1. The UKN1 + SDH + G6PD genes were used as reference gene group and the relative expression levels were determined according the 2^−ΔΔCt method [39 (link),40 (link)]. The specificity of the primer pair was verified by the presence of a single peak in the melt curve analysis during the qRT-PCR process (Figure S1). All biological replicates were performed in triplicate.

Total RNA was extracted from tomato leaves using an RNA extraction kit (Tiangen Biotechnology Co., Ltd., Beijing, China). cDNA was obtained by reverse transcription using the Fastking RT kit (Tiangen Biotechnology Co., Ltd.); corresponding primers were designed according to the CDS sequences of each gene in the tomato genome of Ensembl Plant using Primer 5.0 (Table 4). All PCR reactions were performed in a Light Cycle^® 96 Real−Time PCR System (Roche, Basel, Switzerland) using SYBR Primer Ex Taq^TM II (Tiangen Biotechnology Co., Ltd.). Reaction conditions were as follows: 40 cycles at 95 °C for 15 min, 95 °C for 10 s, 60 °C for 30 s, and 55 °C for 10 s. Relative gene expression was calculated using the 2^−∆∆CQ method [86 (link)].