Pgl3 enhancer vector

In luciferase reporter plasmids, the human TIMP‐3 promoter sequences (from −702 to +18, relative to the transcription start site of the TIMP‐3 gene) were synthesized and constructed into the pGL3‐enhancer vector (Promega, Madison, WI, USA) by the Generay Company (Shanghai, China). All plasmids were confirmed by DNA sequencing. Luciferase reporter constructs containing wild‐type or mutant promoter sequences were named pTIMP‐3 (−702/+18), pTIMP‐3 (mutP53), pTIMP‐3 (mutFOXP1) and pTIMP‐3 (mutE2F) (Fig 4(a)).

Different upstream regulatory regions of the PRDM16 gene were amplified from U251 DNA using PCR with UltraPF DNA polymerase (GeneCopoeia Inc., Rockville, MD, USA). The PCR fragments were digested with MluI/XhoI and linked to the luciferase-based promoter-less plasmid-pGL3-Enhancer Vector (Promega) to create the following plasmids: pGL3-PRDM16-806/-46, pGL3-PRDM16-506/-46, pGL3-PRDM16-256/-46, pGL3-PRDM16-506/-256 and pGL3-PRDM16-806/-506. The sequences and orientations of the cloned fragments were confirmed by direct DNA sequencing. The plasmids used for transfection were isolated and purified using a Purelink Plasmid Mini 25 Reaction Kit (Invitrogen—Life Technologies, Carlsbad, CA, USA). The promoter activities of these fragments were tested via transient transfection of 1 mg of plasmid DNA into the U251 cell lines using the Lipofectamine 3000. For the luciferase-based assay, the results were normalized against Renilla luciferase activity. At least three independent assays were performed.

Murine Sox2 proximal promoter (positions − 1907 to + 6 relative to the transcription initiation site) [32 (link)] was retrieved by PCR from C57B6/J genomic DNA with specific primers containing restriction-site target sequences (prSox2[− 1907/ + 6]-luc-F: AAAAAACTCGAGAAACTTAAGGAGAACCTGGGG; prSox2[− 1907/ + 6]-luc-R: CCACCAAAGCTTAACAAGTTAATAGACAACCATCCA) and cloned into a pGL3-Enhancer vector (Promega). The correct sequence was checked by Sanger sequencing. Cdkn1b^+/+ and Cdkn1b^−/− cells were nucleofected (see “Transfection and viral infection of NSCs”) with 7.5 μg pCDNA3.1 or pCDNA3.1-p27-Flag, 0.5 μg of pMAX-GFP and 2 μg of the corresponding reporter construct (prSox2[− 1907/ + 6]-luc; SRR2[+ 3641/ + 4023]-luc, kindly provided by Dr. Okuda [35 (link)], driving the expression of the firefly luciferase and a Renilla luciferase plasmid in a 1:20 ratio. After electroporation, NSCs were plated on either proliferative or differentiative conditions. Cells were lysed after 72 h (2 + 1 DIV for differentiations) using the Dual Luciferase Reporter kit (Promega, E1960) and luciferase activity was measured using a Victor3 (Perkin Elmer) reader. Ratio of firefly to Renilla luciferase was calculated and represented as arbitrary units (a.u.).

The 5'‐flanking region sequence of pre‐miR‐125b‐1 gene was obtained from the Homo sapiens chromosome 11 (NC_000011.10) after a blast search. The fragments from −1000 to the transcription start site (TSS) of the pre‐miR‐125b‐1(including rs2241490) and from −3590 to −2590 (including rs512932) sequences were separately synthesized and constructed into pGL3‐enhancer vector (Promega, Madison, WI, USA) by Generay Company (Shanghai, China). We validated all the plasmids by DNA sequencing.
For transfection, cells were seeded into 24‐well culture plates and transfected via lipofectamine‐2000 transfection reagent with 0.5 μg constructed luciferase reporter gene plasmids mentioned above. pRL‐SV40 (as internal control) was transiently co‐transfected into cells for correcting transfection efficiency. Twenty‐four hours after transfection, all cells were washed with PBS and lysed with 1 × passive lysis buffer. Luciferase activity was determined by the Dual‐Luciferase Reporter Assay System (Promega, Madison, WI) following the manufacturer's protocol. Each cell line was used in 3 independent transfection experiments, and each experiment was performed in quadruplicate.

For reporter construction, the promoter regions of PTGES1 and PTGES2 were amplified (primer sequences in Appendix Table S8) and introduced into the pGL3 Enhancer vector (Promega) via SpeI and HindIII sites. MDA-MB-436 and Hs-578 T cells (infected with control or miRZIP155 lentiviral vectors) were transfected with reporter vectors (pGL3-PTGES1 or pGL3-PTGES2 or Empty vector) with or without overexpression vector (pcDNA3-cMYC or pEIGW-human KLF4, gift from Dr. Han Seok Choi, University of Ulsan College of Medicine, Seoul, Republic of Korea). After 48 h, luciferase activity was measured using Dual-Luciferase Reporter Assay System (Promega Corp, WI, USA) and Victor Luminometer (Perkin-Elmer, MA, USA).

To make the Myc-Sox2 expression construct, the cDNA encoding human Sox2 was cloned (nucleotide 438 nt to 1391 nt, GenBank Accession: NM_003106) into pcDNA3-Myc vector; and then the Myc-Sox2 was cloned into pLVX- IRES-Puro lentivirus vector to generate the pLVX-Myc-Sox2-IRES-Puro construct. To construct the HAMP promoter driven luciferase reporter plasmid (HAMP-Luc), a 1,000-bp sequence upstream of the translation start codon was amplified from genomic DNA of Huh7 cells using primers containing KpnI and HindIII sites. The PCR product was then cloned into pGL3-enhancer vector (Promega, Madison, WI, USA) [40 (link)]. All the Sox2 binding sites deleted mutants were generated by QuikChange® Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA, USA). All constructs were verified by DNA sequencing analysis. The primer information is available upon request.