Iq5 multicolor real time pcr detection system

Manufactured by Bio-Rad

Sourced in United States, China, Japan, Germany, Italy, Netherlands, United Kingdom

The IQ5 Multicolor Real-Time PCR Detection System is a laboratory equipment designed for real-time polymerase chain reaction (PCR) analysis. It allows for the simultaneous detection of multiple fluorescent dyes, enabling the quantification of gene expression or the identification of specific DNA sequences.

Automatically generated - may contain errors

Lab products found in correlation

Trizol reagent, by Thermo Fisher Scientific (88 mentions) Iq sybr green supermix, by Bio-Rad (59 mentions) Rneasy mini kit, by Qiagen (36 mentions) Trizol, by Thermo Fisher Scientific (32 mentions) Iscript cdna synthesis kit, by Bio-Rad (31 mentions) Primescript rt reagent kit, by Takara Bio (25 mentions) High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (20 mentions) Rneasy plus mini kit, by Qiagen (14 mentions) Sybr premix ex taq 2, by Takara Bio (12 mentions) Sybr premix ex taq, by Takara Bio (12 mentions) Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (12 mentions) Rneasy kit, by Qiagen (10 mentions) Icycler, by Bio-Rad (10 mentions) Iq5 optical system software, by Bio-Rad (9 mentions) Sybr green real time pcr master mix, by Takara Bio (9 mentions) Sybr green supermix, by Bio-Rad (9 mentions) Icycler thermal cycler, by Bio-Rad (8 mentions) High capacity cdna archive kit, by Thermo Fisher Scientific (8 mentions) Rneasy mini kit, by Thermo Fisher Scientific (7 mentions) Primescript rt reagent kit with gdna eraser, by Takara Bio (7 mentions)

Spelling variants of this product

IQ5 system (237 citations) IQ5 detection system (79 citations) Real-Time System (61 citations) IQ5 PCR system (39 citations) Multicolor Real-Time PCR Detection System (25 citations) IQ5 multicolor real-time PCR system (18 citations) IQ5 multicolor detection system (18 citations) ICycler iQ5 multicolor real-time PCR detection system (18 citations) IQ5 Multicolor Real-Time Detection System (7 citations) IQ5 Multicolor (3 citations)

463 protocols using iq5 multicolor real time pcr detection system

Real-Time PCR Protocol for Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Table 1 shows the nucleotide primer sequences originating from human origin. Bio-Rad-iQ™ 5 Multicolor Real-Time PCR Detection System was used to determine the real-time PCR reaction. The analysis was performed using SYBR^® Select Master Mix (CFX), following the recommended instruction. All controls and samples were analyzed using Bio-Rad-iQ™ 5 Multicolor Real-Time PCR Detection System. The data analysis was determined using CFX Manager™ software, version 1.6 (Bio-Rad, Hercules, CA, USA, 2012). Housekeeping genes (glyceraldehyde-3-phosphate dehydrogenase (GAPDH), 18S rRNA, and beta-actin (ACTB)) were used for normalization.

Tan B.L., Norhaizan M.E, & Chan L.C. (2018). An Intrinsic Mitochondrial Pathway Is Required for Phytic Acid-Chitosan-Iron Oxide Nanocomposite (Phy-CS-MNP) to Induce G0/G1 Cell Cycle Arrest and Apoptosis in the Human Colorectal Cancer (HT-29) Cell Line. Pharmaceutics, 10(4), 198.

+ Open protocol

+ Expand

Quantitative Analysis of Autophagy-Related Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from cells using TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc.). RNA (2 µg) was reverse transcribed into cDNA using the iQ5 Multicolor Real-Time PCR Detection system (Bio-Rad Laboratories, Inc.). Subsequently, Real-time PCR analysis was carried out via iQ5 Multicolor Real-Time PCR Detection system (BIO-RAD, USA). And the DNA bands were standardized to that of GAPDH. The primer pairs were as follows: LC3 forward, 5’-GAACGATACAAGGGTGAGAAGCA-3’ and reverse, 5’-TGAGATTGGTGTGGAGACGCT-3’; p62 forward, 5’-TGAGATTGGTGTGGAGACGCT-3’ and reverse, 5’-ACAGCATCTGGGAGAGGGACT-3’; Beclin1 forward, 5’-ATCTGGCACAGTGGACAGTTTG-3’ and reverse, 5’-CCGTAAGGAACAAGTCGGTATC-3’; ATG7 forward, 5’-CAGAAAGGAGGCATGGGACC-3’ and reverse, 5’-AGACACAACCTTGTCCAAGT-3’; FOXO3 forward, 5’-GGACCTGGACATGTTCAATG-3’ and reverse, 5’-CCTGCTTAGCACCAGTGAAG-3’; GAPDH forward, 5’-CCTCTGACTTCAACAGCGACAC-3’; and reverse, 5’-CTGTTGCTGTAGCCAAATTCGT-3’.

Qian J., Cao Y., Zhang J., Li L., Wu J., Wei G., Yu J, & Huo J. (2020). Tanshinone IIA induces autophagy in colon cancer cells through MEK/ERK/mTOR pathway. Translational Cancer Research, 9(11), 6919-6928.

+ Open protocol

+ Expand

Quantitative RT-PCR for Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated using RNase Mini Kit (Qiagen) followed by a reverse transcription reaction with Fermentas Reverse Transcription Reagents (Fermentas). RT-PCR was performed using SYBR Green PCR Master Mix (EuroGene) using BIO-RAD iQ5 Multicolor Real-time PCR detection system (Bio-Rad). PCRs in duplicates for every sample were performed in a final volume of 25 μl reaction mix that contained 50 ng of cDNA product, 100 nmol/L of each primer. For all reactions thermal cycling parameters were: 10 minutes at 95°C followed by 40 cycles of 15 seconds at 95°C, 20 seconds at 59-61°C depended on using primer and 20 seconds at 72°C. The oligonucleotides used as primers (EuroGene) are listed in Additional file 1: Table S1. GAPDH and β-actin were used as reference genes.

Dzhoyashvili N.A., Efimenko A.Y., Kochegura T.N., Kalinina N.I., Koptelova N.V., Sukhareva O.Y., Shestakova M.V., Akchurin R.S., Tkachuk V.A, & Parfyonova Y.V. (2014). Disturbed angiogenic activity of adipose-derived stromal cells obtained from patients with coronary artery disease and diabetes mellitus type 2. Journal of Translational Medicine, 12, 337.

+ Open protocol

+ Expand

Quantitative Analysis of RNA Transcripts

Check if the same lab product or an alternative is used in the 5 most similar protocols

Equal volumes of isolated RNA were used to quantify differences in specific RNA transcripts between samples. cDNA was prepared using the miScript RT2 kit (Qiagen, Hilden, Germany). Per qPCR reaction, 2 μl of 10 times diluted cDNA template was used with 100 nM primers (IDT, Leuven, Belgium) and 4 µL SYBR Green Sensimix (Bioline Reagents Ltd., UK) in an 8 µl reaction. No-RT-controls confirmed the absence of genomic DNA and non-specific amplification. Cycling conditions were 95°C for 10 min followed by 50 cycles of 95°C for 10 s, 57°C for 30 s and 72°C for 20 s. Subsequently, a melting curve analysis was performed.
All PCR reactions were performed on the Bio-Rad iQ5 Multicolor Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA). Quantification cycle (Cq) values were determined using Bio-Rad CFX software using automatic baseline settings. Thresholds were set in the linear phase of the amplification curve.

Driedonks T.A., Nijen Twilhaar M.K, & Nolte-‘t Hoen E.N. (2018). Technical approaches to reduce interference of Fetal calf serum derived RNA in the analysis of extracellular vesicle RNA from cultured cells. Journal of Extracellular Vesicles, 8(1), 1552059.

+ Open protocol

+ Expand

RNA Extraction and Real-Time PCR for Noct Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated using a standard TRIzol extraction (Life Technologies, Carlsbad, CA, USA) method from whole bones that were flash frozen in liquid nitrogen. Five hundred ng of RNA were then reverse-transcribed using a Life Technologies cDNA reverse transcription kit (Life Technologies, Beverly, MA, USA). The cDNA was diluted 1:10 with water. Quantification of mRNA expression was carried out using an iQ SYBR Green Supermix and BioRad iQ™5 multicolor Real-Time PCR detection system (BioRad, Hercules, CA, USA). Primers were designed and tested to be 95–100% efficient by PrimerDesign (South Hampton, UK), Primers used to amplify the Noct (Ccrn4l, P2) P2: 5’-CGGGATTTTGTGGACCTGAG −3’ (forward primer) and 5’-TGTCTTTGCCTTCTCCGAGA −3’ (reverse primer); Additional primer sets were ordered from integrated DNA technologies. Primers used to amplify the Noct WT (P1) close to the Flag Tag, and pTRE2 (Tetracycline response element) Noct 5’ untranslated region (P3) are as follows: P1: 5’-AGCCCCATGAGCTCTTTCTC-3’ (forward primer) and 5’-TAAGGTACCGGGCCCTACTT-3’ (reverse primer); P3: 5’-CGCCTCTCTAACGAATCCCC-3’ (forward primer) and 5’-GCGACTGTAGATCTCCCACG-3’ (reverse primer).

Le P.T., Bornstein S.A., Motyl K.J., Stubblefield J.J., Hong H.K., Takahashi J.S., Green C.B., Rosen C.J, & Guntur A.R. (2019). A novel mouse model overexpressing Nocturnin results in decreased fat mass in male mice. Journal of cellular physiology, 234(11), 20228-20239.

+ Open protocol

+ Expand

Quantitative Expression Analysis of gliZ

Check if the same lab product or an alternative is used in the 5 most similar protocols

The expression of gliZ, relative to that of β-tubulin, was evaluated using Bio-Rad iQ5 Multicolor Real-Time PCR Detection System (Bio-Rad Laboratories Inc., Hercules, CA, USA), as described by Gardiner and Howlett [34 (link)]. Each reaction system of 25 μL contained 12.5 μL of SYBR Premix Ex TaqII (Tli RNase Plus, Takara, Japan) (2× conc.), 2 μL cDNA template, 1 μL of each primer (20 pmol/μL), 8 μL of DNase-free water, and 0.5 μL of ROX as a passive dye. The negative control lacked reverse transcriptase. Real-time PCR included 40 cycles of 95°C for 30 s, 55°C for 30 s, and 72°C for 1 min, followed by a final extension at 95°C for 10 min. All reactions and melting curve analyses were performed in triplicate. Real-time PCR was used to measure the expression levels of the target genes using the comparative computed tomography (CT) method. To obtain the normalized CT value, CT values for each gene were normalized against that of β-tubulin using the equation below.
∆CT = CT (gene of interest) - CT (housekeeping gene)

Mohamed H.M., Haziri I., Saied A.A., Dhama K., Al-Said A.A., Abdou S.E., Kamaly H.F, & Abd-Elhafeez H.H. (2023). Molecular characterization of gliotoxin-producing Aspergillus fumigatus in dairy cattle feed. Veterinary World, 16(8), 1636-1646.

+ Open protocol

+ Expand

Quantifying E-cadherin Expression in Adherent and Suspension Cell Cultures

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

As described previously [15 (link)], total RNA was extracted from 1.0 × 10⁶ cells using the RNeasy kit (Qiagen) and quantified by spectrophotometry (NanoDrop 8000, Thermo Scientific). In certain experiments, cells were grown in suspension by culturing cells onto poly-hema coated wells for 2h (A549) and 3h (BEAS-2B) prior to RNA extraction. Total RNA was subjected to a one-step real-time RT-PCR using the iTaq Universal SYBR Green One-Step Kit (Bio-Rad) and cDNA quantification by real-time PCR on the BIO-RAD iQ5 Multicolor Real-Time PCR Detection System using the human E-cadherin (forward primer: AGGCTAGAGGGTCACCGCGTC and reverse primer: GCTTTGCAGTTCCGACGCCAC). The human GAPDH primers (forward primer: CCCACTCCTCCACCTTTGAC and reverse primer: TTGCTGTAGCCAAATTCGTTGT) were used for control. The Real-time PCR experiments were performed at least three times.

Yao X., Pham T., Temple B., Gray S., Cannon C., Hardy C., Fletcher K., Ireland S.K., Hossain A., Chen R., Abdel-Mageed A.B, & Biliran H. (2017). TLE1 inhibits anoikis and promotes tumorigenicity in human lung cancer cells through ZEB1-mediated E-cadherin repression. Oncotarget, 8(42), 72235-72249.

+ Open protocol

+ Expand

Total RNA Extraction and qRT-PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

For the total RNA extraction, the frozen K. obovata leaves (0.1g) were ground in liquid nitrogen and extracted by using a Total RNA Kit (TaKaRa, Dalian, China). We observed the RNA quality and integrity with an ultraviolet spectrophotometer (Cary 50, Varian, USA) and agarose gel electrophoresis. The RNA was used to synthesized cDNAs with moloney murine leukemia virus (M-MLV) reverse transcriptase First-Strand cDNA synthesis kit (TaKaRa, Dalian, China), and the cDNA mixture was used as a template for subsequent PCRs. The primers used for real-time PCR are shown in Supplementary Table S4. A 10 μL real-time PCR mixture contained 2 μL of primers, 2 μL of cDNA, and 6 μL of SYBR Green (Sangon, Shanghai, China). Five independent biological replicates were used to perform gene expression. The relative gene expression was calculated by the 2^−ΔΔCT method, and actin was used as an an internal control [74 (link)]. The Bio-Rad iQ5 Multicolor Real-Time PCR Detection System (Bio-Rad, Hercules, CA) was used to run qRT-PCR.

Liu Y.L., Shen Z.J., Simon M., Li H., Ma D.N., Zhu X.Y, & Zheng H.L. (2019). Comparative Proteomic Analysis Reveals the Regulatory Effects of H2S on Salt Tolerance of Mangrove Plant Kandelia obovata. International Journal of Molecular Sciences, 21(1), 118.

+ Open protocol

+ Expand

Quantitative PCR analysis of Luc gene

Check if the same lab product or an alternative is used in the 5 most similar protocols

After imaging experiments, animals were euthanized and their lung and liver tissue were harvested and snap frozen. Total DNA was extracted by using DNeasy Blood & Tissue Kit (Qiagen) following the manufacturer’s instructions. 100 ng of purified total DNA form each animal was used as a template. Quantitative real-time PCR was performed in triplicate per template using the inventoried Taqman^® Gene Expression Assays (Cat. #4331182, Life Technologies, Grand Island, NY) with the FAM dye labeled primer set for Luc. Reaction conditions were set as 50°C for 2 min, 95°C for 10 min and 50 cycles of 95°C for 15 sec, 60°C for 1 min followed by the disassociation step of 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec in a Bio-Rad iQ^™5 Multicolor Real-Time PCR Detection system (Bio-Rad Laboratories, Hercules, CA). Data were analyzed by the absolute quantification method using a standard curve by iQ5 v2.0 software (Bio-Rad). Quantified data was normalized relative to the amplification of mouse GAPDH (glyceraldehyde-3-phosphate dehydrogenase) DNA.

Bhatnagar A., Wang Y., Mease R.C., Gabrielson M., Sysa P., Minn I., Green G., Simmons B., Gabrielson K., Sarkar S., Fisher P.B, & Pomper M.G. (2014). AEG-1 promoter-mediated imaging of prostate cancer. Cancer research, 74(20), 5772-5781.

+ Open protocol

+ Expand

Quantitative RT-PCR Analysis of Epidermal Differentiation Markers

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA from the cells was extracted by using TRIzol Reagent (Invitrogen, Carlsbad, CA, USA) in accordance with the protocol of the manufacturer. The OD260/280 ratio of the RNA samples was measured, and the samples with a ratio of 2.0 were used for reverse transcription. In total, 0.5 mg RNA was reverse-transcribed by using PrimeScript RT Master Mix (TaKaRa, Dalian, China). The reactions were performed at 37°C for 15 minutes and then 85°C for 5 seconds. Quantitative RT-PCR analyses were performed in triplicate by using SYBR Green PCR Master Mix (TaKaRa) and detected by using a Bio-Rad iQ5 Multicolor Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA). The data were normalised to β-actin, and the comparative cycle threshold (Ct) method (2^ΔΔCT) was used to calculate the relative quantity of target mRNAs. The primer sequences used are provided in Table 1.Table 1

Names and sequences of primers used for quantitative real-time-polymerase chain reaction

Name	Species	Sense	Antisense
Cytokeratin-5	Human	CATGCAGGACCTGGTGGAAG	CACAAACTCATTCTCAGCAGTGGTA
Cytokeratin-14	Human	GCGGCCTGTCTGTCTCAT	CCACCAGAAGCCCATCAC
Involucrin	Human	TCCTCCAGTCAATACCCATCAG	CAGCAGTCATGTGCTTTTCCT
Stratifin	Human	GCCAAGACCACTTTCGACGAG	CATGATGAGGGTGCTGTCTTTGTAG
Filaggrin	Human	GTGGCAGTCCTCACAGTTCTAGTTC	CCATAGCTGCCATGTCTCCAA
β-actin	Human	TGGCACCCAGCACAATGAA	CTAAGTCATAGTCCGCCTAGAAGCA

Li Z., Han S., Wang X., Han F., Zhu X., Zheng Z., Wang H., Zhou Q., Wang Y., Su L., Shi J., Tang C, & Hu D. (2015). Rho kinase inhibitor Y-27632 promotes the differentiation of human bone marrow mesenchymal stem cells into keratinocyte-like cells in xeno-free conditioned medium. Stem Cell Research & Therapy, 6(1), 17.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!