Sybr premix ex taq

The transcript levels of different samples from A. grossedentata were analyzed by qRT-PCR analysis. The gene-specific primers were designed to perform qRT-PCR analysis for some major transcripts involved in flavonoid biosynthetic pathway (Fig. 5, Additional file 12: Tab. S6). Here the housekeeping gene GAPDH from A. grossedentata was used as an internal standard [56 ]. Gene expression was normalized to that of the housekeeping gene GAPDH. Real-time PCR reactions were performed in triplicate on a MiniOpticon system (Bio-Rad Laboratories, Hercules, CA, USA) using the SYBR Premix Ex Taq™ (TIANGEN, China). Each run contained a series of standards and negative control (using water instead of cDNA). The qRT-PCR protocol was as follows: denaturation at 95 °C for 5 min, followed by 40 cycles of denaturation at 95 °C for 15 s, annealing at 56 °C for 15 s, and elongation at 72 °C for 20 s. The triplicate was conducted for each sample, and the qRT-PCR results were calculated as the mean of 3 replicated treatments.

Wolbachia was quantified by the SYBR Premix Ex Taq in the CFX‐96 Real‐Time PCR system (Bio‐Rad). The primers for qPCR were the wsp gene specific for Wolbachia: wsp‐F: 5′‐TGGTCCAATA AGTGATGAAGAAAC‐3′, wsp‐R: 5′‐AAAAATTAAACGCTACTCCA‐3′ (Ghanim & Kontsedalov, 2009). One β‐actin gene from ACP itself was used as an internal standard for data normalization. The primers of β‐actin were F: 5′‐CCCTGGACTTTGA ACAGGAA‐3′, β‐actin R: 5′‐CTCGTGGATACCGC AAGATT‐3′ (Tiwari et al., 2011). The qPCR reaction was a 25 μl volume containing: 12.5 μl of SYBR Premix Ex Taq (TIANGEN Biotech, Beijing, China), 9.5 μl of RNase‐free water, 0.5 μl of each primer solution (10 μmol/L each), and 2 μl of DNA template for each ACP sample. The qPCR procedure was initiated with 5‐min activation at 95°C followed by 40 cycles of 10 s at 95°C, 30 s at 60°C, and 60 s at 72°C. Again, ten eggs as a unit, one individual of 1st–5th instar nymph, or one male/female adult were detected as one replicate. In total four replicates for each developmental stage were repeated in this qPCR analysis.

Total RNA from atrial fibroblasts was extracted with Trizol Reagent (Invitrogen) according to its operating instructions. Concentration and purity of the samples’ total.
RNA was determined with NanoDrop 2000 spectrophotometer. RNA was diluted proportionally to make a final concentration 200 ng/µL. Next, RNA was reverse-transcribed to cDNA by stem-loop methods with the PrimeScriptTM RT reagent Kit (TAKARA). The primer sequences of miR-499-5p, TGF-β1, α-SMA, collagen-I, smad2 and TGFβ-R1 were designed by Sangon Biotech (Table 1). An ABI PRISM 7500 real-time PCR appliance and SYBR premix Ex Taq (Tiangen) were used to conduct polymerase chain reactions. U6 and GAPDH were used as the internal references for miRNA and mRNA, respectively. Fold changes in the expression of target genes were calculated using 2^−ΔΔCt method.
Table 1

Primer sequences

Gene	Primer sequences
β-actin-F	GGGTTACGCGCTCCCTCAT
β-actin-R	TGGCCATCTCTTGCTCGAAG
miR-499-5p-F	GGGGTTAAGACTTGCAGTG
miR-499-5p-R	CAGTGCGTGTCGTGGAGT
U6-F	CGCTTCACGAATTTGCGTGTCAT
U6-R	GCTTCGGCAGCACATATACTAAAAT
TGF-β1-F	CT GCTGACCCCCACTGATAC
TGF-β1-R	AGCCCTGTATTCCGTCTCCT
Collagen I-F	TGGTGAGACGTGGAAACCTG
Collagen I-R	CTTGGGTCCCTCGACTCCTA
α-SMA-F	GGAGCATCCGACCTTGCTAA
α-SMA-R	CCATCTCCAGAGTCCAGCAC
Smad2-F	GTGGTGGAGAACAGAATGGAC
Smad2-R	CAGTCCCCAAATTTCAGAGCA
TGFB-R1-F	CTTCTCATCGTGTTGGTGGC
TGFB-R1-R	GCCTGTCTCGGGGAATTAGG

Automatic chemistry analysis instrument (Beckman AU5800, BECKMAN COULTER, United States). HSYA (purity > 98%) was obtained from Chengdu Zhibiao Pure (Chengdu, China). The ALT, AST, ALP, SOD, MDA, Hydrogen peroxide, Inhibition and produce superoxide anion assay kits were from Nanjing Jiancheng (Nanjing, China). TNF-α, IL-6, and IL-1β assay kits were from Wuhan Gene Beauty (Wuhan, China). TRIzol reagent, FastKing RT Kit, SYBR Premix Ex Taq were purchased from Tiangen (Beijing, China). Other reagents possessed a higher degree of analytical purity.

A total of four differently m6A methylated genes (EDAR, KRT2, FGF5 and TCHH) were selected for qRT-PCR, which was performed with SYBR Premix ExTaq (Takara, Dalian, China) on ABI 7500 Real-Time PCR System (Applied Biosystems, Foster City, CA, USA). The cDNA synthesis of coding genes was performed using Quantscript RT Kit Quant cDNA (Tiangen Biotech, Beijing, China) with approximately 500 ng of total RNA as the template; SYBR Premix ExTaq (Tiangen, Beijing, China) was used for real-time PCR, which was available for an ABI7500 Real-Time PCR System (Applied Biosystems). The Tm values of each reaction were list in Table S1. The β-actin gene was used as a reference control. Each plate was repeated three times in independent runs for all references. Gene expression was evaluated by the 2^−∆∆Ct method [20 (link)].

A CFX Connect Real-Time PCR Detection system (Bio-Rad, Hercules, CA, USA) was used for the qRT-PCR in this study. Three fishes were used for qRT-PCR analysis. The primer sequence for TLR1, TLR2, Caspase 8, MyD88, FADD, TOLLIP isoform 1 and TOLLIP isoform 2 were listed in Table 1. β-actin was selected and used as reference gene and its amplification effect was realized with specific primers (see Table 1 for sequences). In the PCRs, SuperReal PreMix Plus (SYBR Green) (Tiangen Biotech) was used according to the manufacturer’s protocol. The PCR conducted using the following system, SYBR Premix Ex Taq (from Tiangen Biotech) was 10 μL, the cDNA used here was 40 ng, the final concentration of the primers (referred to anti and sense primer) was 0.2 μM and the making up the final volume of the system to 20 μL with double distilled water. Then the PCR were performed on a Bio-Rad T100 Thermal Cycler amplifier (Bio-Rad, Hercules, CA, USA). with the procedure, initiated 1 min at 95°C, then initiated 5 s at 95°C, annealed 20 s at 60°C and extended 20 s at 72°C. The PCR ends after 40 cycles in the last three steps. At the end of each PCR run, the melting curve analysis was performed in the range of 55°C to 99°C. For each sample, quantitative RT-PCR was performed in triplicate.

Primers (convergent and divergent) were designed using Primer5.0 software. The primers were further synthesized using Synbio Tech (Suzhou, China). Both genomic DNA (gDNA) and cDNA (RNase R+ or RNase R−) were used as templates for convergent and divergent primers. A real-time quantitative polymerase chain reaction (qRT-PCR) was performed to validate the expression of circRNAs. qPCR was carried out in a total volume of 20 µL, containing 10 µL of SYBR Premix ExTaq (2×), 0.5 µL of each primer (10 µM), 2 µL diluted cDNA, and 7 µL ddH2O (TIANGEN). Each sample was amplified with three technical replicates, and all PCR reactions were performed with the BIORAD CFX96 Real-Time System PCR. The qPT-PCR program was as follows: 95 °C for 15 min, followed by 45 cycles of 95 °C for 10 s, 60 °C for 25 s, and 72 °C for 30 s. The specificity of amplification was confirmed by melting curve analysis after 40 cycles. Analysis of gene expression was performed for all samples at 0, 8, and 23 dpi in ‘BJN 222’ inoculated with Pb4 and PbE. The 2^−ΔΔCT method was used to calculate the relative expression of circRNAs [75 (link)]. The primer sequences are listed in Table S5.