Total RNA was isolated using the RNeasy Mini Kit (Qiagen, Germany) according to the manufacturer’s instructions. Reverse transcription of total RNA (1 μg) was performed using a QuantiTect Reverse Transcription Kit (Qiagen, Germany). The reaction was terminated by heating at 95℃ for 5 min. cDNA was amplified using a PCR Premix Kit (i-Taq, iNtRON Biotechnology, Korea) for denaturation at 94℃ for 5 min; 94℃ for 30 s, 5℃ for 30 s and 1 min at 72℃ for 30 cycles, followed by 10 min at 72℃ for elongation using PCR Thermal Cycler Dice (TaKaRa, Japan). The primer sequences were as follows: mouse tyrosinase, 5’-GGCCAGCTTTCAGGCAGAGGT-3’(forward) and 5’-TGGTGCTTCATGGGCAAAATC-3’ (reverse); mouse TRP-1, 5’-GCTGCAGGAGCCTTCTTTCTC-3’(forward) and 5’-AAGACGCTGCACTGCTGGTCT-3’(reverse); mouse TRP-2, 5’-GGATGACCGTGAGCAATGGCC-3’(forward) and 5’-CGGTTGTGACCAATGGGTGCC-3’(reverse), and mouse glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as an internal control, 5’-ACCACAGTCCATGCCATCAC-3’(forward) and 5’-TCCACCACCCTGTTGCTGTA-3’(reverse). The PCR products were analyzed by 1.5% agarose gel electrophoresis with ethidium bromide. The signal intensity of each band was quantified and normalized to the GAPDH signal. Densitometric analysis was performed using Quantity One (Bio-Rad, Hercules, USA) to scan the signals.
Pcr thermal cycler dice
Manufactured by Takara Bio
Sourced in Japan, United States, China, Germany
The PCR Thermal Cycler Dice is a laboratory instrument designed for performing polymerase chain reaction (PCR) amplification of DNA samples. It precisely controls the temperature and duration of the various steps in the PCR process to facilitate the exponential amplification of target DNA sequences.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (7 mentions)
Rneasy mini kit, by Qiagen (4 mentions)
Lightcycler 480 sybr green 1 master kit, by Roche (4 mentions)
Nanodrop lite spectrophotometer, by Thermo Fisher Scientific (4 mentions)
High capacity rna to cdna kit, by Thermo Fisher Scientific (4 mentions)
Platinum taq dna polymerase, by Thermo Fisher Scientific (4 mentions)
Lightcycler 480, by Roche (3 mentions)
Primescript rt reagent kit, by Takara Bio (2 mentions)
Thunderbird sybr qpcr mix, by Toyobo (2 mentions)
Rna extraction solution, by Nippon Gene (2 mentions)
Trizol, by Thermo Fisher Scientific (2 mentions)
Sybr premix ex taq, by Takara Bio (2 mentions)
Easy blue total rna extraction kit, by iNtRON Biotechnology (2 mentions)
M mulv reverse transcriptase, by New England Biolabs (2 mentions)
Taqman universal master mix 2, by Thermo Fisher Scientific (2 mentions)
Exscript rt reagent kit, by Takara Bio (2 mentions)
Trizol ls reagent, by Thermo Fisher Scientific (2 mentions)
Revertra ace qpcr rt master mix, by Toyobo (2 mentions)
Quantity one, by Bio-Rad (1 mentions)
Quantitect reverse transcription kit, by Qiagen (1 mentions)
50 protocols using pcr thermal cycler dice
1
Tyrosinase and TRP Gene Expression
2
Quantitative PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Extracted RNA was quantified with NanoDrop Lite Spectrophotometer (Thermo Fisher Scientific) and reverse transcribed with High-Capacity RNA-to-cDNA kit (Applied Biosystems) and PCR Thermal Cycler Dice (Takara). Using the reverse transcribed cDNA as the template, qPCR was performed with LightCycler 480 SYBR Green I Master kit and LightCycler 480 instrument (Roche). The quality of specific amplification was assessed by the melting curve analysis. The data were normalized by mouse Polr2a. Primers used for qPCR are listed in Supplementary Table S1 .
3
Evaluating Gene Expression in Cisplatin-Induced Kidney Injury
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The kidneys were collected from mice with cisplatin‐induced kidney injury. RNA was extracted from the kidney samples using an RNA extraction solution (NIPPON GENE) according to the manufacturer’s instructions. The cDNA was reverse transcribed using the PrimeScript RT Reagent kit (Takara Bio) and a polymerase chain reaction (PCR) Thermal Cycler Dice (Takara Bio). The cDNA from each sample was mixed with forward and reverse primers and THUNDERBIRD SYBR qPCR Mix (Toyobo); PCR was performed using an Applied Biosystems StepOnePlus machine (Applied Biosystems). Fold changes in gene expression relative to those of the control group were evaluated using mouse glyceraldehyde 3‐phosphate dehydrogenase as the internal standard. The primer sets used for PCR are shown in Table S1 .
4
Gene Expression Analysis of Dental Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
hDPCs, hPDLCs, and hGFs were cultured in 60-mm dishes (1 × 105 cells/dish) for 24 h in control medium (CM) composed of alpha minimal essential medium (α-MEM; Gibco-BRL, Grand Island, NY, USA) containing 10% fetal bovine serum (FBS; Sigma-Aldrich, St. Louis, MO, USA). Following total RNA extraction and first-strand cDNA synthesis, semi-quantitative reverse transcription polymerase chain reaction (RT-PCR) was performed using Platinum Taq DNA polymerase (Invitrogen, Carlsbad, CA, USA) and a PCR Thermal Cycler Dice (Takara Bio, Shiga, Japan). PCR conditions were 94 °C for 2 min and then 94 °C for 30 s, appropriate annealing temperature for 30 s, 72 °C for 30 s for the appropriate number of cycles, and finally 72 °C for 7 min, in accordance with our recent study [16 (link)]. Primer sequences, annealing temperatures, cycle number, and product sizes for SFRP1 and Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) are listed in Table 1 . GAPDH primers were used as internal standards. The RT-PCR products were separated by electrophoresis on 2% agarose gels (Seakem ME; BioWhittaker Molecular Applications, Rockland, ME, USA) containing ethidium bromide.
5
Mutation-Specific PCR Amplification Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For conventional PCR amplification using the mutation-specific primer sets, PCR conditions were as follows: the reaction mixtures contained 2 μl of 10X PCR buffer, 0.5 μl of dNTPs, 1 μl of each allelic-specific primer (10 μM), 0.2 μl of AmpliTaq® Gold DNA polymerase (Applied Biosystems), 1 μl of template DNA, and 14.3 μl of ddH2O in a total volume of 20 μl. Thermal cycling conditions on a PCR Thermal Cycler Dice (Takara, Shiga, Japan) were as follows for the delE746-A750 mutation: 1 cycle at 94°C for 9 min, followed by 35 cycles each consisting of 94°C for 1 min, 59°C for 1 min, and 72°C for 2 min, and a final cycle at 72°C for 5 min. Similarly, for the L858R mutation, conditions involved 1 cycle at 94°C for 9 min, followed by 35 cycles at 94°C for 1 min, 64°C for 1 min, and 72°C for 2 min, and a final cycle at 72°C for 5 min. The PCR products were then electrophoresed on agarose gels and stained with ethidium bromide.
6
Microsatellite Marker Amplification and Visualization
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PCR amplification mixtures consisted of 5 μL of 5× Taq Polymerase buffer, 0.25 μL KAPA Taq HotStart Extra (100 units/μL), 1.5 μL MgCl2 (25 mM), 0.5 μL dNTP (10 mM), 0.5 μL Forward and Reverse primers (100 mM) and made up to 25 μL with sterile ddH2O. The Takara PCR Thermal Cycler Dice® (http://catalog.takara-bio.co.jp/product/basic_info.php?unitid=U100004192 ) was used for SSR marker amplification. First, DNA extract was subjected to one cycle of denaturation at 95°C for 3 min. This was followed by 35 cycles of denaturation at 95°C for 30 s, primer annealing at the appropriate Tm for each primer pair for 30 s and primer extension at 72°C for 30 s. Finally, there was a final extension step at 72°C for 60 s.
For SSR allele identification, we used denaturing polyacrylamide gel electrophoresis (PAGE) using a vertical slab gel DNA sequencer (34 × 45 cm) in a 6% SB (1×) buffer-polyacrylamide gel (Brody and Kern 2004 (link)). Allele visualisation employed the silver staining method, as described by Chevallet et al. (2016). We scored markers manually and selected the polymorphic ones for genetic analysis.
For SSR allele identification, we used denaturing polyacrylamide gel electrophoresis (PAGE) using a vertical slab gel DNA sequencer (34 × 45 cm) in a 6% SB (1×) buffer-polyacrylamide gel (Brody and Kern 2004 (link)). Allele visualisation employed the silver staining method, as described by Chevallet et al. (2016). We scored markers manually and selected the polymorphic ones for genetic analysis.
7
Reverse Transcription and PCR Analysis of Stem Cell Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted with TRIzol (Life Technologies). Total RNA was reverse-transcribed into cDNA using PrimeScriptTM 1st strand cDNA Synthesis kit (Takara, Tokyo, Japan) according to the manufacturer's instructions. Amplification was performed with cycles of 97 °C for 30 sec, 58 °C for 30 sec, and 72 °C for 1 min in a thermal cycler (Takara PCR Thermal Cycler Dice). PCR cycles were 35 for Sox2, Nanog and 28 for β-actin. RT-PCR analysis was performed with the following primers: Sox2 (forward: 5'-CCAAGATGCACAACTCGGAGATCAGC, reverse: 5'- CGAGCCGTTCATGTAGGTCTGCGAG), Nanog (forward: 5'- AGTCCCAAAGGCAAACAACCCACTTC, reverse: 5'- GACTGGCTGTTCTGGGTCTGGTTG), β-actin (forward: 5'-CCCATGCCA TCCTGCGTCTG, reverse: 5'-CGTCATACTCCTGCTTG CTG).
8
Molecular Cloning by Enzymatic Digestion
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Restriction endonucleases and DNA ligase were purchased from Takara Bio Inc. (Otsu, Japan) or New England Biolabs (Ipswich, MA, USA). PCR primers (Table 2 ) were synthesized by Sigma Genosys (Ishikari, Japan) and were used in standard PCR using PCR Thermal Cycler Dice™ (Takara Bio Inc.) and Pyrobest (Takara Bio Inc.), a high-fidelity DNA polymerase.
9
RT-PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RT-PCR analysis was performed as described previously (28 (link)). Total RNA was extracted using TRIzol (Thermo Fisher Scientific). Total RNA was reverse-transcribed into cDNA using the PrimeScriptTM first-strand cDNA synthesis kit (Takara Bio Inc., Shiga, Japan) according to the manufacturer's instructions. Amplification was performed by 28 cycles of 97 °C for 30 s, 58 °C for 30 s, and 72 °C for 20 s in a thermal cycler (Takara PCR Thermal Cycler Dice). RT-PCR analysis was performed using the following primers: MKP-1 (forward, 5′-GGATACGAAGCGTTTTCGGC; reverse, 5′-GGTTGTCCTCCACAGGGATG), survivin (forward, 5′-CCTTTCTCAAGGA-CCACCGCATCT; reverse, 5′-CGCACTTTCTCCGCAGTT-TCCT), and β-actin (forward, 5′-CCCATGCCATCCTGC-GTCTG; reverse, 5′-CGTCATACTCCTGCTTGCTG).
10
Quantifying RON4 and RON5 Transcript Levels in Sporozoites
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To confirm the reduction of ron4 or ron5 transcript levels in RON4-cKD or RON5-cKD sporozoites, real-time reverse transcription (RT)-PCR was carried out using specific primers as shown in Table S1 . Total RNA was extracted from 10 to 15 infected mosquito midguts at days 14 to 15 postfeeding using the RNeasy Micro kit (Qiagen GmbH, Hilden, Germany). After DNase treatment, cDNA was synthesized using a PrimeScript RT reagent kit (Perfect Real Time; TaKaRa Bio, Otsu, Japan). Quantitative RT-PCR was performed using the TaKaRa PCR Thermal Cycler Dice with a SYBR Premix Ex Taq (TaKaRa Bio) and specific primers. A primer set for detection of heat shock protein-70 (hsp70, PBANKA_0711900) was used for normalization (36 (link)). Analysis of transcript levels relative to the average level of the internal control gene was calculated using the delta-CT method (45 (link)). The experiment was performed at least four times using independently prepared samples from different infections, and the mean and standard deviations were determined.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!