Log In Sign up
The largest database of trusted experimental protocols

Chromatin ip kit

Manufactured by Cell Signaling Technology
Visit Supplier
Sourced in United States

The Chromatin IP kit is a laboratory tool designed for the study of protein-DNA interactions. It allows researchers to isolate and analyze the DNA regions that are bound by specific proteins of interest within chromatin. The kit provides the necessary reagents and protocols to perform chromatin immunoprecipitation (ChIP) experiments.

Automatically generated - may contain errors

Lab products found in correlation

Bioruptor, by Diagenode (2 mentions) Klf4 antibody, by Santa Cruz Biotechnology (1 mentions) H3k9me2, by Cell Signaling Technology (1 mentions) Ab58310, by Abcam (1 mentions) Ab133533, by Abcam (1 mentions) S2 sonicator, by Covaris (1 mentions) Normal mouse igg, by Merck Group (1 mentions) Anti errγ, by R&D Systems (1 mentions) Protein g agarose beads, by Cell Signaling Technology (1 mentions) Dna purification columns, by Cell Signaling Technology (1 mentions) Normal rabbit igg, by Cell Signaling Technology (1 mentions) Sybr green master mix, by Yeasen (1 mentions)

13 protocols using chromatin ip kit

1

Chromatin Immunoprecipitation (ChIP) Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
ChIP assay was performed using Chromatin IP kit (Cell Signaling Technology, Beverly, MA, USA) according to the manufacturer's protocol. Briefly, 107 adherent PC3 cells were crosslinked with formaldehyde, collected and digested to produce chromatin fragments. KLF4 antibodies (Santa Cruz, Dallas, TX, USA) and normal goat IgG control (Cell Signaling Technology) were used for ChIP respectively. ChIP DNA was purified and analyzed by qPCR and sequencing. KLF4 relative enrichment was calculated by the formula provided in the protocol. ChIP primers are available in the Supplementary List 5.
Chang Y.L., Zhou P.J., Wei L., Li W., Ji Z., Fang Y.X, & Gao W.Q. (2015). MicroRNA-7 inhibits the stemness of prostate cancer stem-like cells and tumorigenesis by repressing KLF4/PI3K/Akt/p21 pathway. Oncotarget, 6(27), 24017-24031.
+ Open protocol
+ Expand
2

Chromatin Immunoprecipitation Assay for H3K9me2

Check if the same lab product or an alternative is used in the 5 most similar protocols
ChIP experiment was performed using Chromatin IP Kit (Cell Signaling) according to manufacturer's protocol. In brief, GSCs were added with 37% formaldehyde for 10 min, then DNA was processed to the length of 150–900 bp by nuclease digestion and sonication. Chromatin fragment of 10 μg was mixed with G9a (Cell Signaling) or H3K9me2 (Cell Signaling) antibody at 4°C overnight. Protein G magnetic beads of 30 μL were added and incubated for 2 h at 4°C. Chromatin was eluted from beads and determined using qPCR reactions. ChIP primers are the following: Forward: 5’‐CCGGGAGAAGTGGCCCTGGA‐3′, Reverse: 5’‐GAAGCGGTGCTCGTGTCGCT‐3′.
Cao Y., Liu B., Cai L., Li Y., Huang Y., Zhou Y., Sun X., Yang W, & Sun T. (2023). G9a promotes immune suppression by targeting the Fbxw7/Notch pathway in glioma stem cells. CNS Neuroscience & Therapeutics, 29(9), 2508-2521.
+ Open protocol
+ Expand
3

Chromatin Immunoprecipitation (ChIP) Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cell extraction was prepared using Chromatin IP kit (Cell Signaling Technology) according to the manufacturer’s protocol. Briefly, 1 × 107 cells were cross-linked with 37% formaldehyde, collected and digested to produce chromatin fragments for incubation with IgG (Cell Signaling Technology) or specific antibodies for Tead1 (ab133533, Abcam, Cambridge, MA, USA), Tead2 (H00008463-M01A, Abnova, Taipei, Taiwan), Tead4 (ab58310, Abcam) and YAP (#4912, Cell Signaling Technology) respectively. ChIP DNA was amplified and analyzed by qPCR and sequencing. Relative enrichment of specific factors was assessed by the formula provided in the protocol. ChIP primers are listed in the Additional file 1: Table S3.
Zhou P.J., Xue W., Peng J., Wang Y., Wei L., Yang Z., Zhu H.H., Fang Y.X, & Gao W.Q. (2017). Elevated expression of Par3 promotes prostate cancer metastasis by forming a Par3/aPKC/KIBRA complex and inactivating the hippo pathway. Journal of Experimental & Clinical Cancer Research : CR, 36, 139.
+ Open protocol
+ Expand
4

Chromatin Immunoprecipitation of Smad3

Check if the same lab product or an alternative is used in the 5 most similar protocols
ChIP was performed by Chromatin IP kit (Cell Signaling) according to the manufacturer’s instructions. In brief, NRK52 cells treated with CRP for 3h were cross-linked with 1% formaldehyde for 10 mins at room temperature, quenched with glycine, and then sonicated using a Bioruptor (Diagenode, Liege, Belgium) to generate 300- to 600-bp DNA fragments. Immunoprecipitation was performed with the antibody against Smad3 (Cell Signaling), and a mouse IgG was used as a control. Precipitated DNAs were detected by PCR and qPCR using specific primers to detect the binding of Smad3 to p27: Forward 5′- GGTGGACCAAATGCCTGACT and reverse 5′- GCAAAGAGGAGCTACGGAGA.
Lai W., Tang Y., Huang X.R., Tang P.M., Xu A., Szalai A.J., Lou T.Q, & Lan H.Y. (2016). C-reactive protein promotes acute kidney injury by impairing tubular epithelial cell regeneration via the CD32-Smad3-p27 dependent inhibition of CDK2/cyclin E mechanism. Kidney international, 90(3), 610-626.
+ Open protocol
+ Expand
5

Chromatin Immunoprecipitation of BTF3 Binding

Check if the same lab product or an alternative is used in the 5 most similar protocols
HT29 cells were treated with 1% formaldehyde and then quenched with glycine for 5 min at room temperature. ChIP assays were performed using a chromatin IP kit (Cell Signaling Technology, Danvers, MA, United States) according to the manufacturer’s instructions. To perform ChIP analysis of BTF3 binding to the CHD1L promoter, the transcriptional start site was identified using the UCSC Genome browser.5 The analysis was conducted and is shown with IGV (Integrative Genomics Viewer).
Wang H., Xing J., Wang W., Lv G., He H., Lu Y., Sun M., Chen H, & Li X. (2021). Molecular Characterization of the Oncogene BTF3 and Its Targets in Colorectal Cancer. Frontiers in Cell and Developmental Biology, 8, 601502.
+ Open protocol
+ Expand
6

ChIP-qPCR Assay for NF-κB Binding

Check if the same lab product or an alternative is used in the 5 most similar protocols
ChIP assays were performed using the chromatin IP kit (Cell Signaling Technology) following manufacturer’s instructions. Briefly, 4×107 cells were treated with formaldehyde to crosslink proteins to DNA and nuclear/cytosolic fractionation was performed. Nuclear lysates were sonicated using the Covaris S2 sonicator and an aliquot of DNA was purified to check for sonication efficiency (fragments of ~500bp). Anti-p65, anti-IgG and anti-H3 (positive control) antibodies were used to pull down the indicated protein-bound chromatin. Washing, elution and reverse crosslink followed by DNA purification concluded the sample preparation. Quantification of NF-κB (or RELA) enrichment was done using real-time qPCR with primers designed to amplify a 118 bp region spanning nucleotide position 173420380 in the PDHK1 promoter (EpiTect ChIP qPCR Primer Assay for human PDK1, NM002610.3 (−)01Kb, QIAGEN). Assay position: Chromosome 2, 173420380, TSS position: Chromosome 2, 173420779, Assay tile: (−) 01Kb). A standard curve was generated to examine the efficiency of amplification by plotting Ct (threshold cycle) versus DNA quantity (Log10 scale). The fold enrichment was calculated using the following two formulas: Formula 1: Y = M(Log10X) + B (X = DNA quantity, Y = Ct, M = slope of the curve, B = Ct value where X = 1). Formula 2: Fold enrichment = (ChIP DNA Quantity)/(IgG DNA Quantity).
Chatterjee N., Pazarentzos E., Mayekar M.K., Gui P., Allegakoen D.V., Hrustanovic G., Olivas V., Lin L., Verschueren E., Johnson J.R., Hofree M., Yan J.J., Newton B.W., Dollen J.V., Earnshaw C.H., Flanagan J., Chan E., Asthana S., Ideker T., Wu W., Suzuki J., Barad B.A., Kirichok Y., Fraser J.S., Weiss W.A., Krogan N.J., Tulpule A., Sabnis A.J, & Bivona T.G. (2019). Synthetic Essentiality of Metabolic Regulator PDHK1 in PTEN-Deficient Cells and Cancers. Cell reports, 28(9), 2317-2330.e8.
+ Open protocol
+ Expand
7

Chromatin Immunoprecipitation (ChIP) of BRD4

Check if the same lab product or an alternative is used in the 5 most similar protocols
U251 GICs were treated with I‐BET151 and shBRD4. According to the instructions of the Chromatin IP kit (Cell Signaling # 56383S), cells were fasten in 1% formaldehyde at 37°C for 15 min and terminated with glycine (125 mM) for 10 min, then completed cell cross‐linking, then prepared nuclei, and sonic fragmented chromatin by Bioruptor (Diagenode). Chromatin was precipitated with anti‐mouse IgG or anti‐BRD4 (10 µL) with Dynabead magnetic beads. Each sample was evaluated by qPCR in triplicate. Each a Chromatin Immunoprecipitation (CHIP) DNA fragment's Ct value was standardized to the input DNA fragment's Ct value detected by the same qPCR Assay (ΔCt) to illustrate the difference in chromatin sample preparation. Calculate the %Input for each ChIP fraction as 2^ [Ct (input) – Ct (ChIP)] × Fd × 100% (Fd is input dilution factor, equal to 100/5 = 20), and anti‐IgG fold enrichment was evaluated. ChIP primers sequences used are exhibited in Supporting information Table S3.
Tao Z., Li X., Wang H., Chen G., Feng Z., Wu Y., Yin H., Zhao G., Deng Z., Zhao C., Li Y., Sun T, & Zhou Y. (2020). BRD4 regulates self‐renewal ability and tumorigenicity of glioma‐initiating cells by enrichment in the Notch1 promoter region. Clinical and Translational Medicine, 10(6), e181.
+ Open protocol
+ Expand
8

Chromatin Immunoprecipitation of SREBP2

Check if the same lab product or an alternative is used in the 5 most similar protocols
A Chromatin IP kit (Cell Signaling Technology #9002) was used for cell extraction preparation according to the manufacturer’s protocol, as described previously (Jie et al., 2019 (link)). Briefly, after OMT treatment followed by RANKL for 48 h, BMM cells were treated with 1% formaldehyde for 10 min to crosslink chromatin and protein, collected and digested to produce chromatin fragments for incubation with IgG or specific antibodies for SREBP2 respectively. Protein A/G agarose beads were used to incubate the immuoprecipitates. After washed several times, the protein–DNA complex was reversed. Finally, ChIP DNA was amplified and analyzed using qPCR.
Jiang C., Ma Q., Wang S., Shen Y., Qin A., Fan S, & Jie Z. (2021). Oxymatrine Attenuates Osteoclastogenesis via Modulation of ROS-Mediated SREBP2 Signaling and Counteracts Ovariectomy-Induced Osteoporosis. Frontiers in Cell and Developmental Biology, 9, 684007.
+ Open protocol
+ Expand
9

RIP and ChIP Assays for RNA-Protein and Chromatin Interactions

Check if the same lab product or an alternative is used in the 5 most similar protocols
A RIP Kit (Millipore, MA, USA, #17‐700) was used for RIP assay. Briefly, 4 × 107 cells were lysed then incubated with human antiAGO2 antibody at 4°C for overnight. Normal Mouse IgG (Millipore, MA, #17‐700, USA) was used as negative control. Co‐immunoprecipitated RNA was extracted for qRT‐PCR. A Chromatin IP Kit (Cell Signaling Technology, CST, #9002, USA) was used for ChIP assay. Anti‐NF‐kBp65 (CST, USA, #8242) and normal rabbit IgG (CST, USA, #3900) were used. Immunoprecipitated chromatin was measured by qRT‐PCR.
Song J., Lin Z., Liu Q., Huang S., Han L., Fang Y., Zhong P., Dou R., Xiang Z., Zheng J., Zhang X., Wang S, & Xiong B. (2022). MiR‐192‐5p/RB1/NF‐κBp65 signaling axis promotes IL‐10 secretion during gastric cancer EMT to induce Treg cell differentiation in the tumour microenvironment. Clinical and Translational Medicine, 12(8), e992.
+ Open protocol
+ Expand
10

Chromatin Immunoprecipitation of ERRγ

Check if the same lab product or an alternative is used in the 5 most similar protocols
ChIP was performed using the Chromatin IP kit (#9004, Cell Signaling Technology, Danvers, MA, USA). Soluble chromatin was subjected to immunoprecipitation using anti-IgG or anti-ERRγ (#PP-H6812-00, R&D systems, Minneapolis, MN, USA). After DNA recovery, DNA was analyzed by PCR using primers against the hepcidin promoter (forward: 5′-GAGCCACAGTGTGACATCAC-3′; reverse: 5′-GTCTAGGAGCCAGTCCCAGT-3′).
Na S.Y., Kim K.S., Jung Y.S., Kim D.K., Kim J., Cho S.J., Lee I.K., Chung J., Kim J.S, & Choi H.S. (2022). An Inverse Agonist GSK5182 Increases Protein Stability of the Orphan Nuclear Receptor ERRγ via Inhibition of Ubiquitination. International Journal of Molecular Sciences, 24(1), 96.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!