Blend taq

Blend Taq^® and Taq DNA polymerase were purchased from TOYOBO (Osaka, Japan) and New England Biolabs (Ipswich, MA, USA), respectively. T4 DNA Ligase was purchased from Takara Bio (Kusatsu, Japan). Restriction enzymes were purchased from Takara Bio and TOYOBO. Other general reagents were purchased from Wako Pure Chemical Industries (Osaka, Japan) and Nacalai Tesque (Kyoto, Japan).

Culture reagents were from Gibco (Grand Island, NY, USA). ADSCs were cultured in a conventional medium that consisted of Dulbecco’s Modified Eagle’s Medium (DMEM), supplemented with 100-U/mL penicillin G sodium, 100-mg/mL streptomycin sulfate, and 10% vol/vol FBS. Unless otherwise stated, all the other reagents were from Sigma (St. Louis, MO, USA). VPA was from Suju (Guangzhou, China). RG108, Reprogramming Cocktail Set I and purmorphamine were from Biovision (San Francisco, USA). Cell Counting Kit-8 (CCK-8) was from Dojindo (Kyushu, Japan). Cell Cycle and Apoptosis Analysis Kit and Annexin V-FITC/PI apoptosis detection kit were from KeyGEN (Nanjing, China). Monoclonal anti-vimentin (NeoMarkers) was from Lab Vision Corp (Fremont, MO, USA). Goat anti-CD34 polyclonal antibody, goat anti-mouse IgG and goat anti-rabbit IgG were from Santa Cruz Biotechnology (Santa Cruz, CA, USA). EZgeneTM Tissue RNA Miniprep Kit was from Biomiga (San Diego, CA, USA). ReverTra Ace qPCR RT Kit, Blend Taq and Blend Taq-Plus were from Toyobo (Osaka, Japan). Primers were synthetized by BGI (Shenzhen, China).

Cells grown to exponential phase were incubated with YPD medium containing 2 μg/ml tunicamycin or 4 mM DTT, and harvested at the indicated times. Total RNA was then prepared using ISOGEN reagent (Nippon Gene) and the RNeasy Mini kit (Qiagen). First strands of cDNA were generated using the PrimeScript RT reagent Kit (Takara). The HAC1 cDNA was amplified from first strands of cDNA with Blend Taq (TOYOBO), and then analyzed by agarose gel electrophoresis. Detection, quantification, and statistical analysis was carried out by using a LAS-4000 (Fuji Film), ImageQuant (GE Healthcare), and Excel (Microsoft), respectively. The cDNAs of ERO1, KAR2, and SSK1, were quantitated by a quantitative real-time RT-PCR (qRT-PCR) method using a 7500 fast real-time RT-PCR system (Applied Biosystems) with SYBR Premix Ex Taq (Takara). A standard curve was generated from diluted RNA derived from wild-type cells, and levels of gene expression were normalized to ACT1 expression. HAC1 primers (CTGGCTGACCACGAAGACGC and TTGTCTTCATGAAGTGATGA) were used to monitor splicing of HAC1 mRNA. ERO1 primers (TAACAGCAAATCCGGAACG and ACCAAATTTGACCAGCTTGC), KAR2 primers (AGACTAAGCGCTGGCAAGCT and ACCACGAAAAGGGCGTACAG), SSK1 primers (AGCTGGAAGCAGGGAGAAAG and TGAGTGAGGGTTGGAAGGTG), and ACT1 primers (TGCCGAAAGAATGCAAAAGG and TCTGGAGGAGCAATGATCTTGA) were used to analyze the mRNA level of ERO1, KAR2, and SSK1.

Tissues were obtained from female C57/BL6 mice and immediately homogenized in guanidine isothiocyanate solution. Islets were isolated as previously described [9 (link)]. Total RNA extraction and cDNA synthesis were performed as described above. PCR reactions were carried out with Blend Taq (Toyobo) using the following cycling conditions: 94°C for 2 min followed by 25–30 cycles of 94°C for 30 s, 60°C for 30 s, and 72°C for 60 s. Rpl32 expression was used as an internal control [10 (link),11 (link)]. The sequences of the primers used are shown in Table 1.

cDNAs reverse-transcribed from laEBLN-1v1 and laEBLN-1v2 mRNAs were amplified by PCR using Blend taq (TOYOBO) with the primer pairs listed in S5 Table. The PCR product of laEBLN-1v1 was ligated into 3×FLAG-CMV-14 vector (SIGMA) using Ligation high ver.2 (TOYOBO) after digestion with the restriction enzymes HindIII and BamHI (New England Biolabs) at 37°C for 60 min. The PCR product of laEBLN-1v2 was ligated into V5-His-TOPO vector (Life Technologies) according to manufacture’s instructions. The plasmids transformed into TOP10 Competent Cells (Life Technologies) were collected using PureYield Plasmid Midiprep System (Promega) after confirming the insert with nucleotide sequencing. In addition, sub-cloning of ORFs in laEBLN-1v1 and laEBLN-1v2 into pcDNA3.10 vector (Thermo Fisher Scientific) was conducted using the above plasmids as templates for PCR, which were digested with HindIII and BamHI (New England Biolabs).

Total RNAs of preimplantation embryos were extracted with Trizol reagent (Invitrogen) and cDNAs synthesized using SuperScript III reverse transcriptase (Invitrogen), according to the manufacturer’s protocol. PCR was performed with Blend Taq (Toyobo) for 40 cycles of 94 °C for 30 sec, 60 °C for 30 sec, and 72 °C for 30 sec. Primers used are shown in Supplementary Table.