Based on RNAi stock information from flybase (CSN2:BL28290, VDRCGD4682; CSN3:DRSC32997, CSN5:DRSC16592; and CSN7:DRSC06808), 300–500 bp dsRNA fragments of CSN genes were selected. Target dsDNA fragments were amplified by PCR using the T7 promotor. The PCR fragments were purified and extracted. dsDNA was transcribed to dsRNA using the T7 Ultra Kit (Life Technologies, AM1345). S2 cells were resuspended at 1 × 106 cells/ml in serum‐free medium and 1 ml cells was plated into each well of a 6‐well tissue culture plate. 30 µg dsRNA were added to each well. The plates were incubated at room temperature for 30 min, before adding 3 ml complete media with 10% FBS to each well. The cells were incubated for 3 days for further analysis.
T7 ultra kit
Manufactured by Thermo Fisher Scientific
Sourced in United States
The T7 Ultra Kit is a laboratory equipment product designed for in vitro transcription reactions. It provides the necessary components to efficiently produce RNA from DNA templates using the T7 RNA polymerase system.
Automatically generated - may contain errors
Lab products found in correlation
Megashortscript kit, by Thermo Fisher Scientific (14 mentions)
Megaclear kit, by Thermo Fisher Scientific (11 mentions)
Bbsi enzyme, by New England Biolabs (5 mentions)
Rneasy mini kit, by Qiagen (3 mentions)
Qiaquick spin column, by Qiagen (3 mentions)
Puc57 sgrna expression vector, by Addgene (2 mentions)
Pmei enzyme, by New England Biolabs (1 mentions)
Xhoi enzyme, by New England Biolabs (1 mentions)
Pcmv pe2, by Addgene (1 mentions)
Maxiscript t7 kit, by Thermo Fisher Scientific (1 mentions)
Megashortscript t7 kit, by Thermo Fisher Scientific (1 mentions)
Mssi fd, by Thermo Fisher Scientific (1 mentions)
Puc57 sgrna vector, by Addgene (1 mentions)
Pgl3 u6 sgrna pgk puromycin, by Addgene (1 mentions)
Pst1374 nls flag linker cas9, by Addgene (1 mentions)
Megashortscript t7 transcription kit, by Thermo Fisher Scientific (1 mentions)
Femtojet 5247, by Eppendorf (1 mentions)
19 protocols using t7 ultra kit
1
RNAi Knockdown of CSN Complex Genes in Drosophila S2 Cells
2
Generation of EP300 EBS-KO Rats via CRISPR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
EP300 EBS-KO rats were generated with CRISPR genome-editing system in the SD rats. Briefly, several pairs of single guide RNAs (sgRNAs) flanking the last two EBS of EP300 promoter were designed using an online CRISPR design tool.1 Then, Cas9/sgRNA plasmid construction was completed and the sequences were further confirmed by DNA sequencing. UCA™ (Universal CRISPR Activity Assay), a sgRNA activity detection system developed by Biocytogen, was performed to screen two candidate sgRNAs for the next step. Both pT7-sgRNA and pT7-Cas9 plasmids were constructed and used to prepare sgRNAs and Cas9 mRNA with T7 Ultra Kit (Life Technologies). Purified Cas9 mRNA and sgRNAs were mixed and injected into the cytoplasm of fertilized eggs. PCR analysis was performed to verify the rat genotypes, primers were used as follows, forward: 5′- ATT TCT CCT CCA CGG GCT TG-3′ and reverse: 5′- GGA GGA GGG TAC AGC AAC AC-3′. The wild-type allele yielded an amplicon of 588 bp, whereas the mutated allele yielded an amplicon of 304 bp.
3
In Vitro Transcription of Cas9 and sgRNAs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The in vitro transcription templates for Cas9 and sgRNAs were amplified using the T7 promotor-appended primers listed in Table S4 , and were gel-purified using QiaQuick Spin Column (Qiagen, Germany). The Cas9 template was subjected to T7 Ultra Kit (Ambion, AM1345) and the sgRNA templates were transcribed using MEGAshortscript Kit (Ambion, AM1354) in vitro. All of the Cas9 mRNA and sgRNAs were purified using the MEGAclear Kit (Ambion, AM1908).
4
Plasmid Linearization and In Vitro Transcription
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The pCMV-PE2 was purchased from Addgene (132775) [15 (link)]. The PE2 plasmid was linearized by the PmeI enzyme (NEB, Ipswich, MA, USA), and in vitro transcription was performed using the T7 Ultra Kit (Ambion, Austin, TX, USA). According to the manufacturer’s protocols, RNA was purified by the Mini Kit (Qiagen, Hilden, Germany). The expression plasmids of T7 + pegRNA and T7 + nick sgRNA were linearized by the XhoI enzyme (NEB, Ipswich, MA, USA). According to the manufacturer’s protocols, the pegRNAs and sgRNAs were transcribed in vitro by the MEGA shortscript Kit (Invitrogen, Carlsbad, CA, USA) and purified by the MEGA clear Kit (Invitrogen, Carlsbad, CA, USA).
5
CRISPR Reagent Preparation Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The plasmid JDS246 (Cas9; addgene: #43861) was linearized with MssI-FD (Thermo Scientific) and in vitro transcribed with T7 Ultra Kit (Ambion). After polyadenylation, mRNA was purified with RNeasy Mini Kit (Qiagen). sgRNA plasmids were generated via oligo annealing (sgRNA-1_F 5’-TAGGCGAGGGCGATGCCACCTA-3’ , sgRNA-1_R 5’-AAACTAGGTGGCATCGCCCTCG-3’ ; sgRNA-2_F 5’-TAGGTCAGGGTCAGCAGTCCAT-3’ , sgRNA-2_R 5’-AAACATGGACTGCTGACCCTGA-3’ ; sgRNA-3_F 5’-TAgGCATTTGTCAATGGATACCC-3’ , sgRNA-3_R 5’-AAACGGGTATCCATTGACAAATG-3’ ; sgRNA-4_F 5’-TAGGATGATGACATTGCCGCAC-3’ , sgRNA-4_R 5’-AAACGTGCGGCAATGTCATCAT-3’ ) and subsequently ligated into BsaI (Thermo Scientific) digested vector DR274 (addgene: #42250). The template for in vitro transcription was released from purified plasmid with DraI-FD (Thermo Scientific) and transcribed with T7 MAXIscript Kit (Ambion) or T7 MEGAshortscript Kit (Ambion). Purification was performed via ammonium acetate precipitation and phenol/chloroform extraction following the manufacturer’s guidelines. Cas9 mRNA and sgRNAs were stored at -80°C.
6
CRISPR-Cas9 Editing of Sheep MSTN Gene
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The sgRNA design and in vitro transcription (IVT) of Cas9 mRNA and sgRNA were described in our previous study [17 (link)]. Briefly, four sgRNAs (Supplementary Table S1 ) targeting sheep MSTN exon 3 were designed with CRISPR tools (https://benchling.com/ , accessed on 15 September 2020). The oligos for each sgRNA (Supplementary Table S1 ) were annealed and cloned into the pX330 plasmid. The IVT templates for Cas9 and sgRNAs were amplified using the T7 promotor-appended primers (Supplementary Table S2 ) and were gel-purified using a QiaQuick Spin Column (28104Qiagen, Shanghai, China). The Cas9 IVT template (400 ng for a 20 µL reaction) was subjected to a T7 Ultra Kit (AM1345, Ambion, Shanghai, China), and sgRNA IVT templates (200 ng for a 20 µL reaction) were transcribed using the MEGAshortscript Kit (AM1354, Ambion) in vitro. The Cas9 mRNA and sgRNAs were purified using the MEGAclear Kit (AM1908, Ambion). The purified RNAs were quantified using NanoDrop 2000 and then subjected to electrophoresis in 1.5% agarose gel (Supplementary Figure S1 ). The high-quality RNAs were stored at −80 °C before use.
7
In Vitro Transcription of CRISPR Components
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The Cas9 expression plasmid was linearized with Age I and used as the template for in vitro transcription using the T7 Ultra Kit (Ambion, AM1345) [12] (link). sgRNA expression plasmids were linearized with Dra I and used as templates for in vitro transcription using the MEGAshortscript Kit (Ambion, AM1354). Transcribed Cas9 mRNA and sgRNA were both purified by using the MEGAclear Kit (Ambion, AM1908).
8
In vitro Transcription of Cas9 and sgRNAs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The in vitro transcription templates for Cas9 and the sgRNAs were amplified using the T7 promotor–appended primers listed in S3 Table and gel-purified using QiaQuick spin columns (Qiagen, Germany). The Cas9 template was transcribed in vitro using a T7 Ultra kit (Ambion, USA), and the sgRNA templates were transcribed in vitro using a MEGA shortscript kit (Ambion). The resulting Cas9 mRNA and sgRNAs were then purified using a MEGAclear kit (Ambion).
9
CRISPR-Cas9 gRNA In Vitro Transcription
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In vitro transcription was performed according to the protocols reported previously.28 (link) In brief, the pCMV-BPNLS-Gam-xBE3 vector was linearized by BbsI enzyme (New England Biolabs) and performed to in vitro transcription using the T7 Ultra Kit (Ambion) according to the manufacturer’s protocols. All the sgRNAs used for in vitro transcription were cloned into a pUC57-sgRNA expression vector with T7 promoter. Then, the sgRNAs were amplified and transcribed in vitro using the MEGAshortscript Kit (Ambion) and purified using the MEGAclear Kit (Ambion) according to the manufacturer’s protocols.
10
CRISPR/Cas9 Targeting of MCPH1 in Rhesus Monkeys
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Based on the rhesus monkey reference genome (Mmul_8.0.1), two sgRNAs were designed to target the MCPH1 gene with sgRNA1 targeting exon2 and sgRNA2 targeting exon4. The sequences of the two sgRNAs are (PAM in bold): sgRNA1: CCTATGTTGAAGTGTGGTCATCC; sgRNA2: TTACACAGATGCAGGACAGCTGG. The sgRNAs were cloned into PUC57-sgRNA vector (Addgene No. 51132) (Supplementary Table 5 ). The sgRNAs were transcribed by the MEGAshortscript Kit (Ambion, AM1354) after the vectors were linearized by DraI (NEB, R0129S). SgRNAs were purified by the MEGAclear Kit (Ambion, AM1908). Cas9 mRNAs were transcribed by the T7 Ultra Kit (Ambion, AM1345) after the pST1374-Cas9-NNLS-flag-linker vector (Addgene No. 44758) was linearized with AgeI (NEB, R0552S). Cas9 mRNAs were purified by the RNeasy Mini Kit (Qiagen, 74104).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!