Reverse transcriptase

The plated MC3T3-E1 cells were collected at day 14 and were preserved in RNAlater (Genecopoeia). All cells were then pulverized, and total RNA was extracted using TRIzol reagent (Aidlab, China) following the instructions provided. RNA was used to synthesize first-strand cDNA by reverse transcriptase (Genecopoeia). For the polymerase chain reaction (PRC), aliquots of synthesized cDNA were added to PCR mixtures containing Taq polymerase (TAKARA, Japan) and cycled on a DNA thermal cycler. PCR primers were as follows: (1) collagen type I (Col-I) fwd 50 GGCAAAGATGGAGAAGCTGG 30, COL I rev 50 GGAAACCTCTCTCGCCTCTT 30; (2) osteocalcin (OCN) fwd 50 GGACCATCTTTCTGCTCACTC 30, OCN rev 50 CTGCTTGGACATGAAGGCTT 30; and (3) osteopontin (OPN) fwd 50 TCACTCCAATCGTCCCTACA 30, OPN rev 50 GACTCCTTAGACTCACCGCT 30. PCR products were then determined after calculating the optimal annealing temperature for each primer pair by using densitometry and OLIGO Primer Analysis Software.

HD11 cells or DF-1 cells grown into a monolayer were infected with ALV-J or medium as a control, and then treated with TNF-α or Poly (I:C) or with DMEM medium as a control. Cells were harvested at 6, 12 and 24 hpi. Total RNA were isolated using TRIzol reagent and reverse-transcribed using reverse transcriptase according to the manufacturer’s protocol (GeneCopoeia, MD, United States). The specific primers for chicken IFN-α1, IFN-β, NF-κB p65, and GAPDH were designed according to the previous publication (Li Z. et al., 2013 (link)). The qRT-PCR was performed in a 20 μL volume containing 10 μl of 2 × SYBR green Premix Ex Taq, 1 μL of cDNA template, and a 0.5 μM concentration of specific primers. Thermal cycling parameters were as follows: 95°C for 5 min; 40 cycles of 95°C for 10 s, 56°C for 30 s, and 72°C for 30 s and 1 cycle of 95°C for 30 s, 60°C for 30 s, and 95°C for 30 s. All the samples were reacted in triplicate on the same plate, and the GAPDH gene was utilized as the reference gene. Expression levels of genes were calculated relative to the expression of the GAPDH gene and expressed as fold increase or decrease relative to the control samples.