Endotoxin free plasmid maxiprep

The oligo library was amplified using the following primer pair GGCTTTATATATCTTGTGGAA AGGACGAAACACCG (forward) and CTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC (reverse) using Phusion High-Fidelity PCR Master Mix (NEB, #M0531S) with four replicates, followed by purification (Qiagen, #28706). The purified product was cloned into the lentiviral sgRNA expression plasmid LentiGuide-Blast using Gibson Assembly Reaction Master Mix (NEB, #E2611S) as previously described with minor modifications (36 (link)). Briefly, Gibson ligation reaction was performed using 50 ng of the purified PCR product of oligo library and 450 ng BsmBI-digested LentiGuide-Blast with two replicates. Electrocompetent cells (25 μl, Lucigen, #60242) were transformed with 2 μl of the ligation product according to the manufacturer’s protocol using a GenePulser (BioRad) and plated onto 15 cm plates with carbenicillin selection (50 μg/ml). To ensure no loss of representation, eight parallel transformations were performed, which should yield 200× library coverage. Colonies were scraped off plates, combined and used for plasmid DNA extraction with Endotoxin-Free Plasmid Maxiprep (Qiagen, #12362). LentiGuide-Blast plasmid was generated by swapping Blasticidin gene into lentiGuide-Puro (Addgene, #52963).

We amplified the synthesized oligo library using the following primer pair GGCTTTATATATCTTGTGGAAAGGACGAAACACCG (Forward) and CTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC (Reverse) with NEBNext High-Fidelity Master Mix (NEB, #M0531) for 10 cycles. The pooled library cloning process was performed according to our previous publication (25 (link)). Briefly, the amplified oligo library was purified and ligated into BsmBI-digested LentiGuide-Blast using Gibson assembly. Eight transformation reactions were conducted with 2 μl of ligation product into each tube of electrocompetent cells (Lucigen, #60242) and plated onto eight 15-cm plates with Carbenicillin selection (50 μg/ml). After 14 h, all the colonies were collected as a pool for plasmid library extraction with Endotoxin-Free Plasmid Maxiprep (Qiagen, #12362).