Total RNA was extracted using the RNAeasy Plus RNA Extraction Kit (Qiagen). RNA was then quantified using a NanoDrop spectrophotometer (Thermo Fisher Scientific) and cDNA produced using the High-Capacity RNA to cDNA Kit (Thermo Fisher Scientific). Gene expression was then determined using Universal qPCR Mastermix (Thermo Fisher Scientific) with Taqman Gene Expression Assays (Thermo Fisher Scientific) on a BioRad CFX96 qPCR thermocycler. Data are normalized to mouse β ACTIN (ACTB) expression.
Rnaeasy plus rna extraction kit
Manufactured by Qiagen
The RNAeasy Plus RNA Extraction Kit is a laboratory equipment product designed for the purification of total RNA from various biological samples. It utilizes a silica-membrane technology to efficiently capture and purify RNA molecules, enabling researchers to obtain high-quality RNA for downstream applications.
Automatically generated - may contain errors
Lab products found in correlation
Nanodrop spectrophotometer, by Thermo Fisher Scientific (1 mentions)
Taqman gene expression assay, by Thermo Fisher Scientific (1 mentions)
High capacity rna to cdna kit, by Thermo Fisher Scientific (1 mentions)
Cfx96 qpcr thermocycler, by Bio-Rad (1 mentions)
Taqman probe, by Thermo Fisher Scientific (1 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (1 mentions)
2 protocols using rnaeasy plus rna extraction kit
1
RNA Extraction, cDNA Synthesis, and Gene Expression Analysis
2
Quantitative RT-PCR for Influenza and RSV
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The supernatant was removed and the cells were washed and then processed with an RNAeasy PLUS RNA extraction kit (Qiagen) to extract RNA. cDNA was then generated from isolated RNA with a High-Capacity cDNA Reverse Transcription Kit (ThermoFisher). RT-qPCR was then performed for IAV PB1, with Taqman probe (ACACGAGTGGACAAGCTGACACAA) and primers (ATCTTTGAGACCTCGTGTCTTG and CAGCAGGCTGGTTCCTATTTA) or for RSV F, with Taqman probe (TGCCATAGCATGACACAATGGCTCCT) and primers (AACAGATGTAAGCAGCTCCGTTATC and CGATTTTTATTGGATGCTGTACATTT) (ThermoFisher).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!