Seventy-four subjects from the neuroimaging study provided a blood sample, from which DNA was extracted using standard laboratory protocols. DNA was isolated from peripheral blood mononuclearcells using the QIAamp DNA Mini-Kit (QIAGEN, Tokyo, Japan). Genotyping was carried out with a polymerase chain reaction (PCR) SNP genotyping system using the BigDye Terminator v3.1 Cycle Sequencing Kit (Life Technologies Japan, Tokyo, Japan). The DNA was read using a BMG Applied Biosystem 3730xI DNA Analyzer (Life Technologies Japan). We used a forward primer (5′-GGC GTT GCC GCT CTG AAT GC-3′) and a reverse primer (5′-GAG GGA CTG AGC TGG ACA ACC AC-3′) for the 5-HTTLPR polymorphism. The genotyping revealed that all 27 MDD patients had the s/s genotype of 5-HTTLPR. Among 47 HS, 3 had l/s, and 44 had s/s genotypes of 5-HTTLPR. Therefore, the 44 HS with the s/s genotype of 5-HTTLPR were assessed in this study.
3730xi dna analyzer
Manufactured by Thermo Fisher Scientific
Sourced in Japan
The 3730xI DNA Analyzer is a high-performance capillary electrophoresis system designed for DNA sequencing and fragment analysis applications. It features 96-capillary array technology and delivers accurate, reliable, and high-throughput results.
Automatically generated - may contain errors
Lab products found in correlation
Bigdye terminator v3.1 cycle sequencing kit, by Thermo Fisher Scientific (2 mentions)
Qiaamp dna mini kit, by Qiagen (1 mentions)
Qiaampr dna mini kit, by Qiagen (1 mentions)
Gel purification kit, by Qiagen (1 mentions)
Big dye version 3.1 chemistry, by Thermo Fisher Scientific (1 mentions)
96 capillary array, by Thermo Fisher Scientific (1 mentions)
Kapa2g fast readymix, by Roche (1 mentions)
Quickextract kit, by Illumina (1 mentions)
Bigdye terminator kit version 3, by Thermo Fisher Scientific (1 mentions)
Dneasy kit, by Qiagen (1 mentions)
Kapa taq extra hotstart readymix with dye, by Nippon Genetics (1 mentions)
6 protocols using 3730xi dna analyzer
1
Genotyping of 5-HTTLPR Polymorphism in MDD and HS
2
BDNF Val66Met Polymorphism Genotyping
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA was extracted from the blood samples of each of the 49 participants according to standard laboratory protocols. DNA was isolated from peripheral blood mononuclear cells using the QIAamp (R) DNA Mini-Kit (QIAGEN, Tokyo, Japan). Genotyping was carried out with a polymerase chain reaction single nucleotide polymorphism (SNP) genotyping system using a BigDye Terminator v3.1 Cycle Sequencing Kit (Life Technologies Japan, Tokyo, Japan). The DNA was read using a BMG Applied Biosystem 3730xI DNA Analyzer (Life Technologies Japan, Tokyo, Japan). We used a forward primer (ATGAAGGCTGCCCCCATGAAA) and a reverse primer (TGACTACTGAGCATCACCCTG) for the BDNF Val66Met polymorphism. The participants were either homozygous for the Val allele (Val/Val genotype), heterozygous (Val/Met genotype), or homozygous for the Met allele (Met/Met genotype).
The 49 study subjects were divided into groups based on their BDNF genotype. Because the Met/Met genotype is less prevalent in Japan (about 15.9% (Shimizu, Hashimoto & Iyo, 2004 (link))), participants were grouped according to the occurrence of the Met allele, which resulted in two independent groups: Val homozygotes (Val/Val genotype) and Met carriers (Val/Met and Met/Met genotypes).
The 49 study subjects were divided into groups based on their BDNF genotype. Because the Met/Met genotype is less prevalent in Japan (about 15.9% (Shimizu, Hashimoto & Iyo, 2004 (link))), participants were grouped according to the occurrence of the Met allele, which resulted in two independent groups: Val homozygotes (Val/Val genotype) and Met carriers (Val/Met and Met/Met genotypes).
3
APOE Gene Sequencing Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The sequencing of the four coding exons of APOE was undertaken using a five amplicon design, with Exons 1 through 3 amplified as a single amplicon and Exon 4 split in two overlapping amplicons. Exons were amplified via PCR using GoTaq DNA polymerase, 200μM of each dNTP, 1.5 mM MgCl2 and primers specific for each exon (Table 1 ). Thermocycler conditions included an initial denaturation step at 95°C for 2 min, followed by 35 cycles of: 94°C for 30 s, annealing temperature (Table 1 ) for 30 s and 72°C for 30 s. Finally, at the end of the 35 cycles a 7-min adenylation step was undertaken. To remove impurities, unpurified PCR sample templates were cleaned by Solid Phase Reversible Immobilization (SPRI), which utilized paramagnetic beads. The second part of the Exon 4 required the band to be gel purified using the Qiagen gel purification kit. Samples were quantified by gel electrophoresis against a DNA ladder of known concentration. Purified DNA fragments were then sequenced using the Big Dye version 3.1 chemistry (Applied Biosystems) and post-cleaned using SPRI. Fragments were separated on a 3730xI DNA Analyzer, using a 96-capillary array (Applied Biosystems) at the Australian Genome Research Facility (Perth, Australia).
4
Genomic DNA Extraction and Multiplex PCR Amplification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was extracted from 10,000 cells (1 well of a 96-well plate) using 100 μL genomic DNA extraction solution from a Quick Extract Kit (EPICENTRE Biotechnologies, Madison, WI, USA). PCR reactions were performed using KAPA2G Fast ReadyMix (KAPA Biosystems, Salt River, Cape Town, South Africa) and 0.4 μM forward and reverse primers for a total of 35 cycles. For multiplex PCR, the reaction was performed using 50 ng of DNA for 28 cycles. The amplification primers for TBCD and GAPDH were designed to simultaneously amplify target fragments from genomic DNA of 196 bp and 326 bp, respectively.
Sanger sequencing analysis was performed with an Applied Biosystems 3730xI DNA analyzer, using the ABI Prism BigDyeTM Terminator Cycle Sequencing Ready Reaction Kit ver.3.1. (Applied Biosystems, Waltham, MA, USA). Primers for PCR and sequencing are summarized inTable S1 .
Sanger sequencing analysis was performed with an Applied Biosystems 3730xI DNA analyzer, using the ABI Prism BigDyeTM Terminator Cycle Sequencing Ready Reaction Kit ver.3.1. (Applied Biosystems, Waltham, MA, USA). Primers for PCR and sequencing are summarized in
5
Characterization of Antibiotic Resistance Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA was isolated using DNeasy Kit (Qiagen, Hilden, Germany) according to the manufacturer's instructions. Polymerase chain reaction (PCR) was performed using KAPATaq Extra HotStart Ready Mix with dye (NIPPON Genetics, Tokyo, Japan). Serogroups [35 (link), 36 (link)] and phylogenetic groups [37 (link)] were determined by PCR. Multilocus sequence typing (MLST) was determined according to Tartof et al. [38 (link)]. Genes of fosA, fosA3, fosC2 [22 (link)], fosB2, fosC, fosX [26 (link)], fosB [21 (link)], fosA3/4 [25 (link)], and fosKP96 [24 (link)] were detected by PCR using the primers described previously. Gene of fosA5 was detected by PCR using primer set: 5′-ACTGAATCACCTGACCCTGG-3′ and 5′-CGCATAATGGGTGTAGTCGC-3′. Full nucleotide sequences of six genes (murA, uhpT, glpT, uhpA, ptsI, and cyaA) were determined by a combination of direct sequencing and primer walking with the respective PCR products. PCR primer sequences are given in Table 1 . The sequencing was performed with Big Dye Terminator Kit version 3.1 and 3730xI DNA analyzer (Applied Biosystems, Carlsbad, CA) at Hokkaido System Science (Sapporo, Japan).
6
Complementation Analysis of Mutant Rice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
An 8066-bp fragment of genomic DNA plus a 2852-bp upstream sequence that contained the promoter region cloned into the SmaI site of the binary vector pCAMBIA3300 after modification of restriction enzyme sites were used for the complementation analysis of the mutant. The promoter, genomic, and cDNA fragments were amplified using the primer pairs (P7 + P6) and (P5 + P6) and the PCR profile described above. Nucleotide sequences of the cloned fragments were verified by an automated DNA sequencer (3730xI DNA Analyzer, Applied Biosystems, Foster City, CA, USA). These plasmid constructs were electroporated into the Agrobacterium tumefaciens strain LBA4404 and introduced into the homozygote mutant by A. tumefaciens-mediated transformation with some modifications as described previously [54 (link)]. Transgenic rice plants were selected on l -phosphinothricin (6 mg/L) containing medium. l -phosphinothricin resistance transgenic rice plants were transferred to soil and allowed to grow in a greenhouse, as described above, for further phenotypic analysis.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!