Mirna primer

The isolation of total RNA from cells were performed using RNAiso plus Reagent (TaKaRa biotechnology, 9109, Kusatsu, Japan) according to manufacturer's protocol. Subsequently, total RNA was reversely transcribed into complementary DNA (cDNA) by the PrimeScript™ RT Reagent Kit (TaKaRa biotechnology, RR037A, Kusatsu, Japan). Then, qRT-PCR was performed in a Roche LightCycle480 II Real-Time PCR Detection System by SYBR Premix Ex Taq (TaKaRa biotechnology, RR420A, Kusatsu, Japan). The gene primers used in this study were designed and synthesized by BGI (Beijing, China) and were listed in Table 1. miRNA primers were designed and purchased RiboBio Co. Ltd (Guangzhou, China). The expression of gene or miRNA was, respectively, normalized to GAPDH or U6, and calculated by the comparative threshold method of 2^−ΔΔCT.

Dexamethasone was obtained from Shuanghe Pharmaceutical Co., Ltd. (Wuhan, China). Human chorionic gonadotropin (hCG) was purchased from Shanghai Yiyan Biotechnology Co., Ltd. (Shanghai, China). The TRIzol reagent kit was obtained from Invitrogen (Carlsbad, CA, USA). mRNA reverse transcription and real-time quantitative polymerase chain reaction (RT–qPCR) kits were purchased from Vazyme Biotechnology Co., Ltd. (Nanjing, China). miRNA reverse transcription and RT–qPCR kits were purchased from Qiagen Biotechnology Co. (Qiagen, Germany). Some of the primers were synthesized by Tianyihuiyuan Biotechnology Co., Ltd. (Wuhan, China). The miRNA primers and miR-98-3p inhibitor or mimics were obtained from Guangzhou RiboBio Co., Ltd. (Guangzhou, China). Alizarin red dye was purchased from Yuanye Biotechnology Co., Ltd. (Shanghai, China). An alkaline phosphatase color development kit was purchased from Beyotime Biotechnology Co., Ltd. (Shanghai, China). Fetal bovine serum (FBS) and α-MEM were provided by Gibco (St Louis, MO, USA). The antibody for Jagged1 (JAG1) (sc-390177) was purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA, USA). The antibody for Notch1 (CST #4147) was purchased from Cell Signaling Technology, Inc. (Danvers, MA, USA). JAG1 overexpression plasmids were purchased from GeneChem Co., Ltd. (Shanghai, China). Other chemicals and reagents were of analytical grade.

Total RNA in mice thymus, thymocytes and TECS were extracted with Trizol reagent (Takara, Kusatsu, Japan). First-strand cDNA was synthesized with a ReverTra Ace quantitative real time-PCR (qRT-PCR) RT Kit (Toyobo, Osaka, Japan), with random hexamers (for mRNAs and lncRNAs) and stem-loop RT primers (for miRNAs, purchased from RiboBio) according to the manufacturer’s instructions. Primers of mRNAs and lncRNAs (Table S1) were designed by Primer Premier 5.0 software (Premier Biosoft International, USA), and miRNA primers were purchased from RiboBio (Guangzhou, China). β-actin (for mRNAs and lncRNAs) and U6 (for miRNAs) were used to normalize the data. qRT-PCR was performed by a Bio-Rad CFX96 Real-Time PCR system (Bio-Rad, Hercules, CA, USA) using SYBR Green Real-Time PCR Master Mix (Toyobo) following the manufacturer’s instructions. All qRT-PCR assays were conducted in triplicate, and the relative levels were measured in terms of threshold cycle (Ct) and calculated using the formula 2^−∆∆Ct [41 (link)].

Total RNA was extracted using the TRIzol reagent (Invitrogen, CA, United States), and it was reverse-transcribed into cDNAs using the M-MLV reverse transcriptase (Promega, Madison, United States) with Oligo (dT18) RT primers (Sangon, Shanghai, China). Quantitative real-time PCR was carried out using SYBR Master Mixture (TAKARA, Dalian, China). The relative expression levels of the mRNAs were normalized vs. GAPDH expression, and miRNAs were normalized to U6. Comparative quantification was performed using the 2^–△△Ct method. The primer sequences are listed below. (The miRNA primers were purchased from RiboBio Corporation and sequences are displayed by their article number).

Total RNA was isolated using TRIzol reagent (Invitrogen). Complementary DNA (cDNA) was reversely transcribed using TransScript reverse transcriptase (Transgene) with random primers. Primer pairs for qPCR were designed using Primer-BLAST (https://www.ncbi.nlm.nih.gov/tools/primer-blast). Primers were checked for specificity by gel, melting curve analysis, and sequencing. miRNA primers were ordered from Ribobio (China). qPCR cycling was initially performed at 95°C for 2 min, then 40 cycles at the conditions of 95°C/15 s, 60°C/15 s, and 68°C/20 s. The relative expression of each target gene was determined using the formula 2^−△△Ct. GAPDH was used as the internal control while parallel negative control experiments were performed in the absence of cDNA. Sequences of primers were: circ-F: CAGCATCGGAACCAGCAAAG; circ-R: CTGGGCTGTCACTACGGAAG; GAPDH-F: GCTCTCTGCTCCTCCTGTTC; GAPDH-R: ACGACCAAATCCGTTGACTC.