Rnaeasy procedure kit

mRNA qRT-PCR was performed as described previously (26 (link)) on the total RNA extracted from the cells with RNAeasy procedure kit (Qiagen, USA). In brief, reverse transcription using iScript cDNA Synthesis kit (BioRad Laboratories, Hercules, CA, USA) was performed and subsequently the cDNA generated was utilized for PCR in triplicate with TaqMan chemistry on the ABI 7900HT (Applied Biosystems, Foster City, CA, USA). Assays for MCT4 was procured from Applied Biosystems (Foster City, CA, USA). The mRNA expression was calculated relative to the housekeeping gene β–actin.

Quantitative real-time polymerase chain reaction (qRT-PCR) was performed as described previously^{14 (link)} on the total RNA extracted from the cells with RNAeasy procedure kit (Qiagen, USA). Assays for MCT4 (Hs00358829_m1) and LDHA (Hs01378790_g1) were procured from Applied Biosystems (Foster City, CA, USA) and expressed relative to cyclophilin housekeeping gene (Amplicon: TCTCAAATCAGAATGGGACAGGTGGAGAAAGTATTTATGGTGAAAAATTTGAAGATGAAAATTTCCATTACAAGCATGATCGGGAGGGTTTACTGAGCATGGCAAATGCAGGCCGCAACACAAACGGTTCTCA. Forward: TCTCAAATCAGAATGGGACAGGT. Reverse: TGAGAACCGTTTGTGTTGCG. Probe: TTC CAT TAC AAG CAT GAT CGG GAG GGT).