S. aureus strains were inoculated on TSA plates and incubated at 37°C overnight. The next day, a bacterial suspension was adjusted to a 0.5 McFarland (Sensititre® nephelometer and the Sensititre® McFarland Standard) and streaked on MHA. The plates were allowed to dry prior to the addition of 1 μg oxacillin discs (Oxoid) and incubated at 37°C for 48 hours.
Oxacillin discs
Manufactured by Thermo Fisher Scientific
Oxacillin discs are a type of antibiotic susceptibility testing equipment used in microbiology laboratories. They are designed to evaluate the susceptibility of bacteria to the antibiotic oxacillin.
Automatically generated - may contain errors
Lab products found in correlation
2 protocols using oxacillin discs
1
Oxacillin Resistance Screening in S. aureus
2
Identification and Characterization of Staphylococcus aureus
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Aseptic dry swab samples were taken from the pus and wounds. The samples were properly labeled before being transferred to the lab, where they were quickly processed. Specimens were subsequently cultured on Blood Agar and incubated at 37°C for 24 hours. Staphylococcal isolates were identified using biochemical and morphological approaches.35 (link) Multiple biochemical tests for the confirmation of S. aureus were performed on the Gram-positive cocci in cluster detected under the microscope. Identification of S. aureus based on the presence of catalase and oxidase as well as coagulase activity and DNase activity in the S. aureus colonies on mannitol salt agar. Presumptive MRSA was confirmed by Vitek 2 identification card (bioMerieux, Marcy l’Etoile, France) was used for automated strain identification according to the manufacturer’s instructions, and the quality control (QC) strain tested with each run was S. aureus ATCC25923. According to current EUCAST guidelines, methicillin susceptibility was evaluated using oxacillin discs (30 µg, Oxoid) and the mecA gene (F: GATCTGTACTGGGTTAATCA and R: CATATGACGTCTATCCATTT was identified using the PCR approach.36 (link)
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!