The largest database of trusted experimental protocols

18 protocols using mkn 45

1

Rab3IP Regulation in Gastric Cancer

Check if the same lab product or an alternative is used in the 5 most similar protocols
GC cell lines, including AGS, MKN45, BGC823, SGC7901, MGC803, and MKN28, and normal gastric mucosa cells (GES-1), were obtained from Shanghai Cell Bank of the Chinese Academy of Sciences (Shanghai, China) and cultured in RPMI 1640 mixed with 10% foetal bovine serum under 5% CO2 at 37 ºC. Plasmids containing Rab3IP cDNA (the sequence results are shown in Supplementary materials) and Rab3IP-specific siRNAs (5'CCAGTGGGATTACAACCTA3') were purchased from OBIO Biotechnology Company (Shanghai, China). Rab3IP-knockdown lentiviruses were obtained from GeneChem Company (Shanghai, China) and were used to establish the Rab3IP-knockdown cell lines, namely AGS-Rab3IP (-) cells. Rab3IP overexpressing lentiviruses were also from GeneChem Company (Shanghai, China) and were used to generate the Rab3IP-overexpression cell lines, namely MKN45-Rab3IP (+) cells. Negative control cell lines were also established, called AGS-Rab3IP (-)-NC and MKN45-Rab3IP (+)-NC cells. The miR-450-5p, miR-217, miR-532-3p, miR-935, and miR-584-5p mimics as well as the negative control were purchased from OBIO Biotechnology Company (Shanghai, China) and transfected into GC cells, using the Lipofectamine 2000 Transfection Reagent (Thermo Fisher, USA).
+ Open protocol
+ Expand
2

Cell Culture of Gastric Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
The human immortalized normal gastric mucosa GES-1 and gastric carcinoma MGC803, BGC823, SGC-7901, MKN-45 and HGC27 cell lines were purchased from Shanghai GeneChem Co., Ltd and conserved in the Laboratory of China Medical University Gastrointestinal Oncopathology. The cell lines were cultured in RPMI 1640 (Hyclone, Thermo scientific, USA) supplemented with 10% fetal bovine serum (Hyclone, USA) in a humidified atmosphere containing 5% CO2 at 37 °C.
+ Open protocol
+ Expand
3

Gastric Cancer Cell Line Culture

Check if the same lab product or an alternative is used in the 5 most similar protocols
The human GC cell lines HGC27, BGC823, MKN45, SNU-1 and the normal gastric epithelial cell line GES1 were purchased from GeneChem (Shanghai, China), identified by STR profiling and tested free of mycoplasma contamination. All cell lines were cultured in high glucose DMEM (HyClone, Logan, Utah, USA) supplemented with 10% fetal bovine serum (Gemini, Calabasas, CA, USA) and 1% penicillin–streptomycin (Gibco, Grand Island, NY, USA) in a humidified incubator in 5% CO2 at 37 °C.
+ Open protocol
+ Expand
4

EGF-Induced HCCR-1 Expression in GC Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Six GC cell lines (AGS, SGC-7901, MKN-45, MKN-28, MGC-803, and BGC-83) and one normal gastric mucosa cell line (GES-1) were purchased from GeneChem (Shanghai, China) and cultured in RPMI-1640 medium (Corning, USA). The SGC-7901 cells were cultured in serum-free RPMI-1640 medium for 24 hours, followed by culturing in different EGF (Abcam) concentrations (0, 60, and 120 ng/mL) for 24 hours and culturing in 60 ng/mL of EGF for different periods (0, 12, and 24 hours). Changes in the expression of HCCR-1 were then detected in the cells by WB.
+ Open protocol
+ Expand
5

Culturing Gastric Cancer Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
The AGS, MKN45, SGC7901, and HGC27 GC cell lines and the control GES-1 gastric mucosal cell line were obtained from GeneChem (Shanghai, China). The MFC cell were obtained from Pricella (Wuhan, China). All cells were grown in RPMI-1640 supplemented with FBS (10%) at 37 °C in a humidified 5% CO2 incubator.
+ Open protocol
+ Expand
6

Gastric Cancer Cell Line Manipulation

Check if the same lab product or an alternative is used in the 5 most similar protocols
A normal human gastric epithelial cell line (GES-1) and three GC cell lines (HGC-27, AGS and MKN-45) were acquired from BNCC (Beijing, China). MKN-45 and HGC-27 cells were cultured in RPIM-1640 medium, AGS cells in DMEM/F-12 medium and GES-1 cells in DMEM medium. All culture media were purchased from Gibco (United States), and were supplemented with 1% penicillin-streptomycin and 10% fetal bovine serum. Genechem (Shanghai, China) provided the green fluorescent protein-labeled miR-204-3p overexpression lentiviral vector (OE group), miR-204-3p knockdown lentiviral vector (KD group) and empty lentiviral vector (NC group), which were then transfected into HGC-27, MKN-45 and AGS cells using the tool virus user manual as a guide.
+ Open protocol
+ Expand
7

Gastric Cancer Cell Line Culturing

Check if the same lab product or an alternative is used in the 5 most similar protocols
Seven GC cell lines (AGS, BGC823, MGC803, MKN45, MKN1, SGC7901, and HGC27), a gastric mucosa cell line (GES-1), and human kidney cell line (HEK293T) were purchased from GeneChem (Shanghai, China). Cells were cultured in RPMI-1640 medium supplemented with 10% FBS at 37 °C in a humidified atmosphere with 5% CO2.
DAPI, Baf-A1, and 3-MA were obtained from Solarbio (Beijing, China). NAC was purchased from Beyotime (Shanghai, China), and 740Y-P (also known as 740YPDGFR) was obtained from MCE (Monmouth Junction, NJ, USA).
+ Open protocol
+ Expand
8

Establishing Gastric Cancer Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
Gastric cancer cell lines: HGC-27, SNU-1, SGC-7901, NCI-N87, KATOIII, AGS, MKN-28, MKN-45, BGC-823, MGC-803 and GES-1 were purchased from the Chinese Academy of Sciences (Shanghai, China), and were cultured in corresponding medium containing 10% fetal bovine serum (FBS). All the cell lines were kept at 37°C in 5% CO2. To obtain KLF2 over-expressing cells, BGC823 and MKN45 cells were infected with lentivirus encoding GFP-KLF2 (KLF2) or GFP (as control) (Shanghai Genechem Co., LTD.). MGC803 cells were infected with lentivirus encoding shRNA KLF2 or scrambled shRNA used as negative Control Duplex (Hanbio Biotechnology Co., Ltd.) to obtain KLF2 knockdown cells. Three different shRNA sequences were used: shRNA1: sense5’-GATCCGCGGCACCGACGACGACCTCAATTCAAGAGATTGAGGTCGTCGTCGGTGCCGTTTTTTC-3’, antisense 5’- AATTGAAAAAACGGCACCGACGACGACCTCAATCTCTTGAATTGAGGTCGTCGTCGGTGCCGCG-3’; shRNA2: sense5’- GATCCGCCTACACCAAGAGTTCGCATCTGAATTCAAGAGATTCAGATGCGAACTCTTGGTGTAGGTTTTTTC-3’, antisense 5’- AATTGAAAAAACCTACACCAAGAGTTCGCATCTGAATCTCTTGAATTCAGATGCGAACTCTTGGTGTAGGCG-3’; shRNA3: 5’- GATCCGCGCTGCACATGAAACGGCACATGTATTCAAGAGATACATGTGCCGTTTCATGTGCAGCGTTTTTTC-3’, antisense 5’- AATTGAAAAAACGCTGCACATGAAACGGCACATGTATCTCTTGAATACATGTGCCGTTTCATGTGCAGCGCG-3’. The transfected cells were selected in culture medium plus puromycin (1.0 μg/ml) for 3 weeks to obtain stable KLF2-overexpressing and KLF2-deficient cells.
+ Open protocol
+ Expand
9

Culturing Gastric Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
The normal human gastric epithelial cell line GES-1 and human GC cell lines BGC823, SGC7901, MKN45, and HGC27 were purchased from Genechem Co., Ltd., Shanghai, China. These cell lines were then preserved in the Gastrointestinal Onco-Pathology Laboratory of China Medical University. Cells were maintained in RPMI1640 medium (Gibco®; Thermo Fisher Scientific, Waltham, MA, USA) supplemented with 10% FBS (Cellmax, Sydney, Australia), 100 units/mL of penicillin, and 100 µg/mL of streptomycin (Gibco®; Thermo Fisher Scientific, Waltham, MA, USA), and grown in a humidified atmosphere with 5% CO2 at 37°C. The culture medium was changed every other day.
+ Open protocol
+ Expand
10

Gastric Cancer Tissue Collection and Cell Culture

Check if the same lab product or an alternative is used in the 5 most similar protocols
Tumor tissues and adjacent non-tumor tissues were randomly collected from 138 GC patients treated between April 2012 and October 2014 at the Department of Oncology Surgery, the First Affiliated Hospital of Medical College, Xi'an Jiaotong University, PR China. None of the patients reported to have been pretreated with chemotherapy or radiotherapy. By reviewing the patients’ pathology records, we obtained their clinicopathological such as their age and gender, histology data, lymph node metastasis status, lymphatic and venous invasion status, tumor size, T stage and pTNM stage. Tumor stage was defined based on the criteria of the American Joint Committee on Cancer (AJCC). The study was approved by the Ethical Committee of Xi'an Jiaotong University. Informed consent was obtained from all the patients before samples were collected. Human GC cell lines, including BGC-823, AGS, MKN-45, SGC-7901 and GES-1, were obtained from the Cell Bank (Shanghai Genechem Co., Ltd, Shanghai, China). The cell lines have been authenticated and tested by the Cell Bank. For verification, we performed mycoplasma tests in our laboratory, and the cell behavior and morphology were proved consistent with the descriptions in the Cell Bank. Cells (1 × 105 cells/ml) were cultured in RPMI-1640 (Gibco BRL, Grand Island, NY, USA) supplemented with 10% fetal bovine serum (Gibco) at 37 °C.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!