Puromycin selection

Lentivirus particles expressing YAP1 were produced by GenePharma Co. Ltd. China. HT-29, and Caco-2 cells were transfected with the Lentivirus particles using an LV5 vector with a YAP1 insert. Stably transfected cells with GFP were sorted using flow cytometry (BD FACS Aria II; BD Biosciences, Franklin Lakes, NJ, USA) and isolated using puromycin selection (Solarbio, Beijing, China).

Lentiviral small hairpin RNA targeting LMNB1 (lv-sh-LMNB1) and empty lentiviral vector (lv-sh-con) were purchased from Hanbio (Shanghai, China). The sequence of sh-LMNB1 was 5’- GATCCGCGCTTGAAGAACACTTCTGAATTCAAGAGATTCAGAAGTGTTCTTCAAGCGTTTTTTG -3’. HepG2 and Hep3B cells were infected with lentivirus to construct stably transfected cell lines. After 72 h, we removed negative cells through puromycin selection (Solarbio).

NK1R knockdown was performed as previously described [23 (link)]. The lentivirus particles containing shNK1R were obtained from OBIO Technology (Shanghai, China). The shRNA sequences were cloned into lentiviral vector pLKD-CMV-EGFP-Puro respectively (shctrl: 5´-TTCTCCGAACGTGTCACGT-3´; shNK1R 1#: 5´-GCAACCAGCCTG GCAAATT-3´; shNK1R2#: 5´-GCCTGTTCTACTGCAAGTT-3´). Cells were transfected with the lentivirus particles according to the manufacturer’s instructions followed by puromycin selection (5 μg/ml, Solarbio, Beijing, China). For NK1R overexpression, pLenti-EGFP-Puro-CMV-NK1R plasmid (OBIO) was transfected into cells with GC Liposomal Transfection Reagent (Genecarer, Xi’an, China) followed with puromycin selection.
A dual sgRNA CRISPR/Cas9 system was used to delete the ARE1 sequence in the enhancer region of the NK1R gene. Briefly, sgRNA sequences (sgRNA-F: 5’-GTACGA ATAGCCATCATATCCTGG -3’; sgRNA-R: 5’-GTCCTAAGAGCATTACACCTG AGG-3’) were cloned into the vector of Lenti-CRISPR-dual gRNA. The cells were transfected with Lenti-CRISPR-dual gRNA-ARE1 or vector control plasmid with GC Liposomal Transfection Reagent for 48 h, then harvested for the analysis of ARE1 deletion efficiency using Takara ExTaq PCR kit (Dalian, China) with the forward primer 5’-AGCGGTTTCCCAGTAGAGTC-3’ and the reverse primer 5’-AAGGGTTCAGCATGTTCTGC-3’.