Revertra acer
ReverTra AceR is a reverse transcriptase enzyme used in molecular biology applications. It is designed for the synthesis of first-strand cDNA from RNA templates.
Lab products found in correlation
3 protocols using revertra acer
Potato Transcriptome Analysis via RT-qPCR
Quantitative gene expression analysis
TGF-β1 Induced Epithelial-Mesenchymal Transition
confluence. When the cultured cells reached 50–55% confluence, medium was replaced with
DMEM supplemented with 0.5% FBS containing TGF-β1 (10
ng/ml−1) for 7 days to induce EMT cells.
The medium was changed every 2 days. Total RNA was extracted by using Trizol reagent
(Invitrogen, Tokyo, Japan). First-strand cDNA was synthesized by using a random nine-mer
primer and ReverTra Ace(R) (a high efficient M-MLV; Moloney Murine Leukemia
Virus reverse transcriptase) (Toyobo, Tokyo Japan) at 30°C for 10 min, 42°C for 1 hr, 99°C
for 5 min, and 4°C for 5 min. PCR amplification was performed by using ExTaq DNA
polymerase. Primers used for PCR analysis are shown in
Primer sets | Orientation | Sequence (5′ to 3′) | PCR product (bp) |
---|---|---|---|
Rat-α-SMA (NM_031004) | Forward | GGGAGTGATGGTTGGAATGG | 197 |
Reverse | CCGTTAGCAAGGTCGGATG | ||
Rat E-cadherin | Forward | ATCTAAAGCTTCACAAGCTGGA | 502 |
Reverse | TGATCTGTGACTGTGACCACTA | ||
Rat-TnC (XM_008763758.2) | Forward | ATGTTGAATGGCGACAC | 188 |
Reverse | CGGTCTCCAAACCCAG | ||
Rat-GAPDH (XM_576394) | Forward | TCCCTCAAGATTGTCAGCAA | 308 |
Reverse | AGATCCACAACGGATACATT |
tenascin-C.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!