Femtojet micromanipulator

OC-STAMP^-/- and MMP12^-/- knockout mice were produced by Beijing View Solid Biotechnology, China. Briefly, the pCAG-T7-SaCas9 plasmid linearized by AvrII restriction was used as an in vitro transcriptional template. After purification, saCas9 mRNA was transcribed with the mMESSAGE mMACHINE™ T7 ULTRA Transcription Kit (Life Technology). Target gRNA templates were amplified based on the gRNA scaffold using T7 promoter sequence-conjugated primers (S7 Table) and then transcribed using a fast in vitro transcription T7 kit (cat. no. VK010, Beijing View Solid Biotechnology, China) and frozen at -80°C. Zygotes of C57BL/6 mice were injected with saCas9 mRNA and target gRNA in M2 media (Millipore) using a FemtoJet micromanipulator (Eppendorf, Germany). Following microinjection, zygotes were transferred to pseudo pregnant female mice. All mice were maintained in a specific pathogen-free facility. The tail-derived DNA from 2-week-old newborn mice was genotyped by sequencing the PCR products amplified by primers (S7 Table). Mutant mice were mated with wild-type C57BL/6 mice to obtain heterozygous knockout mice.

TALEN-mediated Hmox1 knockout rats were produced by Beijing View Solid Biotechnology, China. TALEN constructs in the TALEN-L and TALEN-R expression vectors were prepared with a HiSpeed plasmid midi kit (Qiagene), and the vectors were linearized with NotI. TALEN-L and TALEN-R mRNAs were transcribed in vitro using the MESSAGE mMACHINE® SP6 Kit (Invitrogen) with a T7 promoter. Zygotes of SD rats (n = 120) were injected with TALEN-L and TALEN-R mRNAs in M2 media (Millipore) using a FemtoJet micromanipulator (Eppendorf, Germany). After microinjection, the zygotes were transferred to pseudopregnant females. Tail-derived DNA from 2-week-old newborn rats was genotyped by sequencing PCR products amplified by the following primers: HO1-T4-sens (TTGACAGCTGGGCTGAAATGCAC) and Hmox1-T4-anti (TTCTGCGCAATCTTCTTCAGGAC). A 507 bp DNA fragment containing the TALEN target site was amplified, and the mutant Hmox1 alleles were confirmed by PCR sequencing to identify frameshift mutations. The mutant rats were mated with wild-type SD rats to obtain heterozygous Hmox1+/− rats (Figures 1(a) and 1(b)).

MYOC-transgenic mice were produced by Beijing View Solid Biotechnology, China. The plasmid pCAG-MYOC was linearized by BstEII restriction enzyme (NEB) digestion, purified, and injected into zygotes of C57BL/6 mice in M2 media (Millipore) using a FemtoJet micromanipulator (Eppendorf, Germany). Microinjected zygotes were transferred into pseudo-pregnant female mice. All mice were maintained in a specific pathogen-free facility. Genotype identification was performed by PCR and sequencing from 2-week-old newborn mice (Table S5). Transgenic mice were mated with wild-type C57BL/6 mice to obtain heterozygous mice and colony expansion.