Bgc 823

5 gastric cancer cell lines MGC-803, BGC-823, SGC-7901, MKN1 and MKN45 were purchased from the Cell Bank of Chinese Academy of Sciences (Shanghai, China), and cultured in RPMI-1640 containing 10% fetal bovine serum (MKN45 with 20% FBS). To generate CD163 knocking-down BGC-823 and SGC-7901 cell lines, 1×10⁴ cells were seeded into 12-wells plates, and infected with Lentivirus coated shRNA plasmids (5′- GGCTGTGGAGAGGCCATTAAT -3′) or control plasmids (5′-CAGTACTTTTGTGTAGTACAA -3′) according to the instruction (GenePharma, China). Puromycin was added 72 hours after infection at the concentration of 2 μg/mL (Sigma, P9620) until no dying cells were visible. For transfection assays, 2×10⁵ cells were seeded into 6-wells and transfected with Higene (Applygen, C1506) following the manufacture's guidelines. Cells were washed with PBS and harvested with RIPA lysis buffer 48 hour after transfection.

The 96-well plates were seeded with 5000 cells per well and transfected at 12 h. LV-HNF1A-AS1, as well as the blank control LV-NC, were transduced into MKN-45 and BGC-823 cells, respectively, following the lentiviral instructions (GenePharma). After 24 h, the medium was replaced with normal medium, and after 72 h, the cells were observed under fluorescence microscopy for green fluorescence. The culture of lentivirus-infected cells was expanded. LV-NC served as the control group, and cells were collected every seven days for RNA extraction to detect transduction efficiency using qRT-PCR analysis.