Control sirna

NHTE cells at passage 2 were seeded at 2 × 10⁵ cells/well onto collagen-coated 12-well cell culture plates. ATG5 chimera siRNA (ATG5 siRNA, H00009474-R01, Abnova, Taipei, Taiwan) or Naito1 chimera RNAi (control siRNA, R0017, Abnova) was transfected into cells at 60–70% confluence using siRNA transfection reagents (Santa Cruz Biotechnology Inc., Santa Cruz, CA) according to the manufacturer's instructions. Twenty-four hours after siRNA transfection, cells were treated with or without 100 mM trehalose for 48 h to induce autophagy. Thereafter, cells were infected with HRV-16 at 10⁴ TCID₅₀/well or sterile PBS (control) as described above. Cells were processed to examine ATG5 knockdown by Western blot, IFN-λ1 mRNA expression and HRV RNA levels by quantitative RT-PCR after 6 h of HRV-16 infection when the anti-viral response is expected to peak.

Control siRNA (no target in mammalian cells, R0017) was purchased from Abnova, Walnut, CA. siRNA against atr (5′AACGAGACTTCTGCGGATTGCAGCA3′) and msh2 (5′AATCTGCAGAGTGTTGTGCTTAGTA3′) were supplied by Invitrogen (Stealth RNAi siRNA duplex). SiRNA against xrcc1 (M-009394-01-0005), ape1 (M-010237-00-0005), mlh1 (J-003906-10-0005), pcna (D-003289-10-0005, M-003289-02-0005 for rescue), apobec3b (J-017322-08-0005), apobec3c (J-013711-08-0002) and apobec3f (J-019039-17-0005) were purchased from Dharmacon RNAi Technologies / GE Healthcare, Fairfield, CT.