Mature rat miR-628 (AUGCUGACAUAUUUACGAGAGG) was cloned into a pcDNA6.2-GW/EmGFP-miR vector (GenePharma Co., Ltd., Shanghai, China) using a BLOCK-iT Pol II miR RNAi Expression Vector Kit (Life Technologies, Grand Island, NY, USA). The rat IRS1 mRNA 3'-UTR sequence (1069 base pairs) was cloned into a pGL3 luciferase assay vector (IRS1 3'-UTR luciferase reporter). Antibodies against IRS1, Akt, p-Akt S473, FoxO3a, p-FoxO3a S253, MuRF-1, MAFbx and cleaved caspase 3 were purchased from Cell Signaling Technologies (Beverly, MA, USA). β-Actin antibodies were purchased from Sigma-Aldrich (St Louis, MO, USA). The pan-caspase inhibitor Z-VAD-FMK was purchased from Abcam (Cambridge, MA, USA).
Pcdna6.2 gw emgfp mir vector
Manufactured by GenePharma
Sourced in China
The PcDNA6.2-GW/EmGFP-miR vector is a plasmid designed for the expression and detection of microRNA (miRNA) in mammalian cells. It contains the EmGFP (Emerald Green Fluorescent Protein) gene, which allows for the visualization of transfected cells, and a Gateway cloning site for the insertion of miRNA sequences.
Automatically generated - may contain errors
Lab products found in correlation
Murf1, by Cell Signaling Technology (1 mentions)
Block it pol 2 mir rnai expression vector kit, by Thermo Fisher Scientific (1 mentions)
Mafbx, by Cell Signaling Technology (1 mentions)
Z vad fmk, by Abcam (1 mentions)
Foxo3a, by Cell Signaling Technology (1 mentions)
Pakt s473, by Cell Signaling Technology (1 mentions)
Cleaved caspase 3, by Cell Signaling Technology (1 mentions)
β actin antibody, by Merck Group (1 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (1 mentions)
2 protocols using pcdna6.2 gw emgfp mir vector
1
Validating miR-628 Regulation of IRS1
2
Overexpressing miR-100 and CXCR7 in LM3 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The miR-100 precursor (mimic) was provided and transferred into pcDNA6.2-GW/EmGFP-miR vector by Genepharm company (Hangzhou, Zhejiang, China). A miRNA with the sequence of “5′-AGGTACGAAACGCTAAGAAT-3′” was used as the control [10 (link)]. The guidelines of Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) were used to perform transfection. LM3 cell line was transfected with pcDNA6.2/miR-100 to construct overexpressing miR-100 cell line. Similarly, the full-length CXCR7 sequence was subcloned into pBabe-CXCR7 retroviruses vectors, provided by Genepharm company (Hangzhou, Zhejiang, China), to construct overexpressing CXCR7 LM3 cell line. All transfected cells were selected with 2.0 μg/ml puromycin for 7 days.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!