Ten RAD-Seq libraries were prepared for the 142 offspring and two parents following standard protocol [25 (link)]. Briefly, 1 µg of genomic DNA from each sample was digested with PstI restriction enzyme (Thermo Scientific, MA, USA) and incubated for 10 min in FastDigest buffer (total volume: 30 µL) at 65 °C. Barcode adapters (F: AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA, R: AAGTCGGATCGTAGCCATGTCGTT CTGTGAGCCAAGGAGTTG) containing a sample-specific nucleotide code were designed following the standard Illumina adapters design protocol. A total of 10 µmol of unique barcode adapters from each DNA sample was added to the reaction system. Sixteen samples were pooled within each tube. Nine pools were collected, and fragments between 300 and 500 bp were selected. Finally, sequencing was conducted using the Illumina Hiseq 4000 platform (Illumina, CA, USA) with 150-bp paired-end strategy.
Psti restriction enzyme
Manufactured by Thermo Fisher Scientific
Sourced in United States
PstI is a type II restriction enzyme that recognizes and cleaves the DNA sequence 5'-CTGCAG-3'. It is commonly used in molecular biology applications such as DNA manipulation, cloning, and genetic analysis.
Automatically generated - may contain errors
Lab products found in correlation
Hiseq 4000, by Illumina (1 mentions)
Gotaq flexi buffer, by Promega (1 mentions)
Gotaq flexi dna polymerase, by Promega (1 mentions)
Anti methyl cytosine antibody, by Diagenode (1 mentions)
Novaseq 6000 platform, by Illumina (1 mentions)
Mboii restriction enzyme, by Thermo Fisher Scientific (1 mentions)
Taq dna polymerase, by Sinaclon (1 mentions)
5 protocols using psti restriction enzyme
1
Multiplexed RAD-Seq Library Preparation
2
Degenerated CAPS for G181A SNP Genotyping
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Degenerated CAPS (dCAPS) was developed to genotype the G181A SNP detected by sequencing. The primers (mos_Pst1_F1 and mos_dcaps_R1; Supplementary Table 2 ) were designed using dCAPS Finder 2.040 (link). PCR reactions were performed in a volume of 15 µl with 10 ng genomic DNA, 1 X Green GoTaq® Flexi buffer, 0.125 mM dNTPs, 2 mM MgCl2, 0.2 µM of each primer, and 0.1 U GoTaq® Flexi DNA polymerase (Promega Corporation, Madison, WI, USA), with the following program: 95 °C for 3 min, 40 cycles (95 °C for 30 s, 60 °C for 40 s, and 72 °C for 30 s), and 72 °C for 5 min.
Amplified PCR fragments were then digested using PstI restriction enzyme (#ER0615, Thermo Fisher Scientific Inc.) according to the manufacturer’s instructions. The digestion led to the production of three DNA fragments for the allele, with a guanine at position 181, RoKSNG181 (37, 50 and 64 bp), and two DNA fragments for the allele with an adenine at the same position, RoKSNA181 (64 and 87 bp). DNA fragments were separated on a Resophor gel (4.5% w/v), stained with ethidium bromide.
Amplified PCR fragments were then digested using PstI restriction enzyme (#ER0615, Thermo Fisher Scientific Inc.) according to the manufacturer’s instructions. The digestion led to the production of three DNA fragments for the allele, with a guanine at position 181, RoKSNG181 (37, 50 and 64 bp), and two DNA fragments for the allele with an adenine at the same position, RoKSNA181 (64 and 87 bp). DNA fragments were separated on a Resophor gel (4.5% w/v), stained with ethidium bromide.
3
Methylome Profiling Using Illumina Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The genome was first digested with the PstI restriction enzyme (Thermo Scientific; Waltham, MA, USA) in a suitable range (≈450 bp) for Illumina (San Diego, CA, USA) sequencing [26 (link)]. Then, illumina sequencing barcodes are ligated to each end of the digested DNA fragments, allowing the pool of DNA samples to be immunoprecipitated together. Each pooled DNA sample contains different barcodes identifying each individual reduced genome. Then, a 50 ng fraction of the DNA pool, representing the genetic background of the libraries, hereby called inputs, was amplified by PCR. Then, the methylated fraction of the sampled DNA was captured by an anti-methyl-cytosine antibody (Diagenode, Sparta, TN, USA) [29 (link)]. After this step, the methylated DNA was amplified using PCR, which is followed by a clean-up of the primer dimers and unbound adapters [79 (link),80 (link)]. The procedure generated a library that corresponds to the methylated portion of the reduced genome. The libraries were quantified, clustered, and end-paired sequenced in the Illumina NovaSeq6000 platform with a read length of 150bp at the SNP & SEQ facilities of the SciLifeLab (Uppsala, Sweden).
4
Restriction Fragment Length Polymorphism Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The omp2a gene amplification products were digested with 10–20 U pstI restriction enzyme (Thermo Fisher Scientific, Waltham, MA) according to the manufacturer’s procedure and incubated at 37 °C for 4 h. The restricted fragments were separated by 1% agarose gel electrophoresis. The PCR-RFLP patterns were recorded using gel documentation.
5
Assessing H6PD Variants via PCR-RFLP
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Polymerase chain reaction (PCR) amplification was used to assess the variants of H6PD
(R453Q and D151A) followed by the restriction fragment length polymorphism (RFLP)
analysis. PCR primers for amplification of the region spanning the selected polymorphisms
were designed using NCBI (https://www.ncbi.nlm.nih.gov/) and Oligo 7 software (Table 1 ).
PCR was performed in a total volume of 25 µl containing 2.5 μL of 10X PCR buffer, 20 pmol
of each forward and reverse primers (SinaClon BioScience Co., Iran), 1.5 mM
MgCl2 , 0.2 mM dNTPs (SinaClon BioScience Co., Iran), 1 unit of Taq DNA
polymerase (SinaClon BioScience Co., Iran) and about 100 ng of extracted DNA as a
template. The thermal cycler program included an initial denaturation at 95°C for 5
minutes, 35 cycles of denaturation at 95°C for 40 seconds, annealing at 62°C (R453Q)/64°C
(D151A) for 35 seconds, extension at 72°C for 40 seconds, and finally one cycle of
extension at 72°C for 5 minutes. To perform RFLP, 10 µl of PCR products were digested with
2 units of MboII restriction enzyme (Thermo, USA) at 37°C for D151A and PstI restriction
enzyme (Thermo, USA) at 37°C for R453Q, for 15 hours. Products of enzyme digestion were
visualized after 2% agarose gel electrophoresis and staining with GelRed (Kawsarbiotech,
Iran) under ultraviolet light (Figes.1 , 2 ).
(R453Q and D151A) followed by the restriction fragment length polymorphism (RFLP)
analysis. PCR primers for amplification of the region spanning the selected polymorphisms
were designed using NCBI (https://www.ncbi.nlm.nih.gov/) and Oligo 7 software (
PCR was performed in a total volume of 25 µl containing 2.5 μL of 10X PCR buffer, 20 pmol
of each forward and reverse primers (SinaClon BioScience Co., Iran), 1.5 mM
MgCl2 , 0.2 mM dNTPs (SinaClon BioScience Co., Iran), 1 unit of Taq DNA
polymerase (SinaClon BioScience Co., Iran) and about 100 ng of extracted DNA as a
template. The thermal cycler program included an initial denaturation at 95°C for 5
minutes, 35 cycles of denaturation at 95°C for 40 seconds, annealing at 62°C (R453Q)/64°C
(D151A) for 35 seconds, extension at 72°C for 40 seconds, and finally one cycle of
extension at 72°C for 5 minutes. To perform RFLP, 10 µl of PCR products were digested with
2 units of MboII restriction enzyme (Thermo, USA) at 37°C for D151A and PstI restriction
enzyme (Thermo, USA) at 37°C for R453Q, for 15 hours. Products of enzyme digestion were
visualized after 2% agarose gel electrophoresis and staining with GelRed (Kawsarbiotech,
Iran) under ultraviolet light (Figes
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!