The sensitivity of the MLVA primers (Supplementary Table 1 ) was determined using DNA from D. nodosus isolates and swab samples. Improvements in sensitivity were made by changing the PCR Master mix (From Promega x2 PCR Master Mix to Bioline MyTaq™ Red Mix), increasing primer concentration (from 10 pmoles of each primer in a 50 μl reaction to 10 pmoles of each primer in a 25 μl reaction), DNA template concentration (from 1 μl/50 μl reactions to 1 μl/25 μl reactions) and the number of PCR cycles (from 30 to 40 cycles). The final protocol was, in 25 μl reactions; 12.5 μl MyTaq™ Red Mix (Bioline, London, United Kingdom), 1 μl of each primer (10 μM stock concentration; Supplementary Table 1 ), 1 μl bovine serum albumin (20 mg ml−1) (Sigma Aldrich, Dorset, United Kingdom) and 1 μl of DNA template. DNA from D. nodosus strain 4303 LBV and nuclease free H2O were used as positive and negative controls, respectively. All PCR reactions were carried out on an Eppendorf Mastercycler ep gradient machine (Eppendorf, Hamburg, Germany) using the following cycling conditions: One cycle of 95°C for 2 min, 40 cycles of 95°C for 1 min, 59°C for 30 s and 72°C for 1 min with a final extension of 72°C for 2 min. PCR products were visualized by ethidium bromide-stained agarose gel electrophoresis and imaged using a Gene Flash imager (Syngene Bio Imaging, Cambridge, United Kingdom).
Mytaq red mix
Manufactured by Meridian Bioscience
Sourced in United Kingdom, Australia, United States, Germany
MyTaq Red Mix is a ready-to-use 2x reaction mix for PCR amplification. It contains MyTaq DNA Polymerase, reaction buffer, dNTPs, and a red dye for direct gel loading.
Automatically generated - may contain errors
Lab products found in correlation
T100 thermal cycler, by Bio-Rad (10 mentions)
T00 thermal cycler, by Bio-Rad (8 mentions)
Pcr isolate 2 pcr and gel kit, by Meridian Bioscience (7 mentions)
Trizol reagent, by Thermo Fisher Scientific (7 mentions)
Sybr green master mix, by Thermo Fisher Scientific (6 mentions)
Isolate 2 genomic dna kit, by Meridian Bioscience (5 mentions)
Dneasy blood and tissue kit, by Qiagen (5 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (5 mentions)
Sybr safe dna gel stain, by Thermo Fisher Scientific (4 mentions)
Qiaamp dna mini kit, by Qiagen (3 mentions)
Gotaq qpcr master mix, by Promega (3 mentions)
Cfx96 touch real time pcr, by Bio-Rad (3 mentions)
Pcr clean up and gel extraction kit, by Macherey-Nagel (3 mentions)
S1000 thermocycler, by Bio-Rad (3 mentions)
Superscript 3 first strand synthesis system, by Thermo Fisher Scientific (3 mentions)
Goscript reverse transcriptase, by Promega (2 mentions)
Cfx96 touch real time pcr detection system, by Bio-Rad (2 mentions)
Pcr index primers sequences 1 12, by Illumina (2 mentions)
Gel doc ez gel documentation system, by Bio-Rad (2 mentions)
Rneasy mini kit, by Qiagen (2 mentions)
160 protocols using mytaq red mix
1
Sensitive MLVA Primer Detection of Dichelobacter nodosus
2
Two-Step PCR for Site-Directed Mutagenesis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The reference sequence was generally generated in a two-step PCR reaction (Supplementary Figure S1 ). Two complementary primers (primers c and d) were designed that carried the designed mutations as present in the donor template. Two standard PCR reactions were done with 50 ng wild-type genomic DNA in MyTaq™ Red mix (Bioline) using primers a and c and primers b and d. PCR thermocycling scheme: 1 min at 95°C (1×), followed by 15 sec at 95°C, 15 s at 55°C and 20 s 72°C (25–30×). The two PCR products were purified using the PCR ISOLATE II PCR and Gel Kit (Bioline). Next, the resulting two PCR amplicons (each 1 μl) were combined with 48 μl buffer (10 mM Tris, 50 mM NaCl, 1 mM EDTA) and denatured for 5 min 95°C and cooled down (0.1°C/s) to 25°C. Of this mixture 3 μl was subsequently used as template in a PCR reaction with MyTaq™ Red mix (Bioline) with primers a and b, starting with an extension step as follows: 15 s at 72°C (1×), followed by 15 s at 95°C, 15 s at 55°C, and 20 s 72°C (25–30×). The PCR products were purified using the PCR ISOLATE II PCR and Gel Kit (Bioline).
The following primer pairs spanning the to be edited site were used (c: reverse; d: forward):
The following primer pairs spanning the to be edited site were used (c: reverse; d: forward):
3
Targeted Integration Verification in Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For mice that received the GR-Hpd scgRNA and the GR-Cypor scgRNA, PCRs using MyTaq Red Mix (Bioline) were performed to show correct integration of the targeting rAAV vectors into the Albumin locus. For these PCRs the primers called 2nd Alb PCR from the table below were used. For mice that received the GR-Stop scgRNA with different homology arms, nested PCRs were performed to detect integration events using MyTaq Red Mix (Bioline). Both sets of PCR primers were designed to span the integration junction with one primer outside of the arm of homology and one primer in the hF9 or P2A transgenes. Nested PCRs were performed by diluting the initial PCR product 1:100 and using 1 μL in the subsequent nested PCR. Primers used are listed in Table 1 . Samples were electrophoresed on a 1.2–1.4% agarose gel (Thermo Fisher Scientific) with a Gene Ruler 1 kb plus DNA ladder (Thermo Fisher Scientific) for visualization.
4
Extraction and Amplification of gDNA and cDNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
gDNA from individual rosette leaves of T4 and T7 generations was extracted by CTAB as previously described, from lines #236 and #289. PCR was carried out as follows using primers P3–P4 (Supplemental Table S1 ) and MyTaq Red Mix by Bioline�: 94� for 5′, 25 cycles of 94� for 30″, 58� for 30″, and 72� for 60″.
For cDNA analysis of variants, RNA extracted as previously described, and treated with DNAse I by Invitrogen� as per manufacturer’s instruction. Of about 1.5-�g RNA were retrotranscribed with SuperScript™ III First-Strand Synthesis System by Invitrogen�, following manufacturers instruction, PCR for variant analysis was carried out as follows using P3–P4 (Supplemental Table S1 ), and MyTaq Red Mix by Bioline�: 94� for 5′, 29 cycles of 94� for 30″, 58� for 30″, and 72� for 60″.
ACT2 was amplified from cDNA using primers listed inSupplemental Table S1 and PCR was carried out as follows: 94� for 5′, 26 cycles of 94� for 30″, 58� for 30″, 72�.
For cDNA analysis of variants, RNA extracted as previously described, and treated with DNAse I by Invitrogen� as per manufacturer’s instruction. Of about 1.5-�g RNA were retrotranscribed with SuperScript™ III First-Strand Synthesis System by Invitrogen�, following manufacturers instruction, PCR for variant analysis was carried out as follows using P3–P4 (
ACT2 was amplified from cDNA using primers listed in
5
Antimicrobial Resistance Profiling in S. uberis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All S. uberis isolates were screened for AMR genes using PCR. The screened AMR genes included blaZ and pbp2b for beta-lactam resistance; tetL, tetO, and tetM for tetracycline resistance; ermB and mefA for macrolide resistance; and aac(6′)-Ie-aph(2″)-Ia, aph(2″)-Ib, and aph(2″)-Id for aminoglycoside resistance. The primers used for each gene are listed in Table 1 . The PCR mixture (25 μL) contained 0.5 μL of forward and reverse primers (10 mol/L); 12.5 μL of 2X Taq Master Mix containing 1.25 U of Taq DNA polymerase, 1X ViBuffer A, 0.2 mM dNTPs, and 1.5 mM MgCl2 (MyTaq™ Red Mix; Bioline, NSW, Australia); 11 μL of DNase-free water; and 0.5 μL of DNA template (50–100 ng/μL). The tubes were placed in a thermal cycler with the following program: initial denaturation at 94°C for 5 min; 35 cycles of denaturation at 94°C for 30 s; annealing temperature as shown in Table 1 , for 30 s; and an extension at 72°C for 60 s. The PCR products were determined by 2% agarose gel electrophoresis, stained with ethidium bromide, and visualized under ultraviolet illumination.
6
Transgenic Rabbit Sperm Characterization
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Semen was collected from both TG and non-TG bucks using artificial vagina.
Somatic cells were removed from ejaculated sperm by percoll gradient (90%) centrifugation for one hour as described in [10 (link)]. RNA was purified from the separated spermatozoa fraction by RNAzol RT reagent (MRC) according to the manufacturer’s instructions. cDNA were reverse transcribed with Applied Biosystems High-capacity cDNA Reverse Transcription Kit (Life Technologies) from 200 ng RNA. The RT-PCR reactions were set up with MyTaq Red Mix (Bioline) reagent according to the manufacturer’s instructions. The following primer pairs were used to RT-PCR:
Venus specific primer: Forward: 5’ GGTCCCTCTTCTCGTTAGGG 3’
Reverse: 5’ TACAAGACCAGAGCCGAGGT 3’;
Neonatal rabbit Fc receptor specific primer [19 ];
Ribosomal 28S subunit specific primer, Forward: 5' GTTGTTGCCATGGTAATCCTGCTCAGT 3', Reverse: 5' TCTGACTTAGAGGCGTTCAGTCATAAT 3'
Somatic cells were removed from ejaculated sperm by percoll gradient (90%) centrifugation for one hour as described in [10 (link)]. RNA was purified from the separated spermatozoa fraction by RNAzol RT reagent (MRC) according to the manufacturer’s instructions. cDNA were reverse transcribed with Applied Biosystems High-capacity cDNA Reverse Transcription Kit (Life Technologies) from 200 ng RNA. The RT-PCR reactions were set up with MyTaq Red Mix (Bioline) reagent according to the manufacturer’s instructions. The following primer pairs were used to RT-PCR:
Venus specific primer: Forward: 5’ GGTCCCTCTTCTCGTTAGGG 3’
Reverse: 5’ TACAAGACCAGAGCCGAGGT 3’;
Neonatal rabbit Fc receptor specific primer [19 ];
Ribosomal 28S subunit specific primer, Forward: 5' GTTGTTGCCATGGTAATCCTGCTCAGT 3', Reverse: 5' TCTGACTTAGAGGCGTTCAGTCATAAT 3'
7
Genomic Analysis of IDS Variants
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic analysis of IDS variants was performed by Applied StemCell (Milpitas, California). Briefly, QuickExtract™ DNA Extraction Solution (Lucigen) was used to extract genomic DNA from TRNDi008-A cells. PCR amplifications (MyTaq™ Red Mix, Bioline) were carried out on a T00 Thermal Cycler (Bio-Rad) using the following program: 95 °C, 2 mins; 35 cycles of [95 °C, 15 s; 60 °C, 15 s; 72 °C], elongation duration varies by amplicon size, 72 °C 5 mins; 4 °C, indefinite. Sanger sequencing analysis was performed for genotyping of the hemizygous mutation of a 1 bp insertion at nucleotide 208 in exon 2 of the IDS gene. The specific primers for gene amplification and sequencing are listed in Table 2 .
8
Virulence Gene Screening in Gram-positive Bacteria
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Gram-positive and catalase-negative colonies were screened for the presence of virulence genes by PCR, using primers for various common virulence genes listed in Supplementary Table S5 . Virulent genes including agg, gelE, cylM, cylB, cylA, esp, efaAfs, efaAfm, cpd, cob, ccf and cad were detected for Enterococcus and Streptococcus strains as described by Eaton and Gasson53 (link). For Lactobacillus strains, besides gelE, esp, cylA and efaAfs, other virulent genes hyl, asa, ace, hdc, tdc and odc were included and detected as reported by Casarotti et al.54 (link). PCR was carried out in a 20-µL reaction mixture with MyTaq™ Red Mix (Bioline) buffer. PCR products were detected on 1.0% agarose gel electrophoresis and using gel imaging system (Kodak Image Station 4000 R; Carestream Health Inc., Rochester, NY).
9
Genetic Polymorphism Analysis of TNF Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
One hundred microliters (100 μl) of the sample (whole blood) was worked upon for extracting DNA using the Quick-gDNA™ MiniPrep kit (catalog No: D3024, USA). Amplification was performed through repetitive cycles of DNA denaturation, primer annealing and extension by DNA polymerase using MyTaq™ Red Mix (Bioline, Australia). The primers for TNF-α and TNF-β genes were provided by (Biosearch Technologies, USA). The restriction enzyme (RE) used is NcoI-HF (Biolabs, New England, no. 0061510). TNF-α (-308 G/A) and TNF-β (+ 252 A/G) gene polymorphisms among cITP patients and control group were interpreted according to the number of bands and bp of each genotype (Figures S1 and S2 shown in supplementary file).
10
Nematode DNA Extraction and ITS Region Amplification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
One entire nematode from each sample was taken for DNA isolation, using the QIAamp DNA Mini Kit (Qiagen, Hilden, Germany). After the DNA was extracted, the entire ITS1-5.8S-ITS2 region was amplified by PCR with the primers NC5 (5′-GTAGGTGAACCTGCGGAAGGATCATT-3′) and NC2 (5′-TTAGTTTCTTCCTCCGCT-3′) (Zhu et al., 1998 (link)). PCR reactions were performed with 25 μl Mastermix (MyTaq™ Red Mix, Bioline, London, United Kingdom), 1 μl forward primer, 1 μl reverse primer and 5 μl target DNA, replenished with distilled water to a total reaction volume of 50 μl. The PCR started with an initial denaturation step at 95 °C for 1 min, followed by 35 cycles of denaturation at 95 °C for 15 s, annealing at 55 °C for 15 s and elongation at 72 °C for 10 s. Reactions were carried out using a Biometra T Gradient thermocycler (Biometra GmbH, Göttingen, Germany). In order to verify the amplification quality, 10 μl of the PCR products were visualised by ultraviolet light (monitor: Santec Peqlab, Peqlab (VWR), Erlangen, Germany; darkroom: Vilber Lourmat Deutschland GmbH, Eberhardzell, Germany) on SYBR® Safe DNA (Invitrogen (Thermo Fisher Scientific), Waltham, USA) (1.5 μl) stained 1.5% agarose gels (UltraPure™ Agarose, Invitrogen (Thermo Fisher Scientific), Waltham, USA), using a 100-bp DNA ladder (4 μl) (Quick-Load®, New England Biolabs GmbH, Frankfurt am Main, Germany) as molecular marker.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!