The largest database of trusted experimental protocols

Fetal bovine serum (fbs)

Manufactured by Beyotime
Sourced in China, United States, Germany

Fetal bovine serum (FBS) is a supplement derived from the blood of bovine fetuses. It is a complex mixture of proteins, growth factors, hormones, and other components that support the growth and proliferation of cells in cell culture systems. FBS provides essential nutrients and growth-promoting factors to maintain and expand a variety of cell lines in vitro.

Automatically generated - may contain errors

154 protocols using fetal bovine serum (fbs)

1

Culturing Primary Rat Hippocampal Neurons

Check if the same lab product or an alternative is used in the 5 most similar protocols
Primary cultures of hippocampus neurons were obtained and cultured according to previously described protocol (12) . Briefly, primary rat hippocampus samples were prepared from Sprague-Dawley rat brains at embryonic days 1-3, which were purchased from the Experimental Animal Center of China Medical University (Beijing, China) and were dissected in calcium-and magnesium-free Hank's balanced salt solution (Beyotime Institute of Biotechnology, Haimen, China), following incubation with a 0.25% trypsin solution for 30 min at 36˚C in order to obtain primary hippocampus neuron cells. Cells were maintained in Dulbecco's modified Eagle's medium (DMEM)/high glucose, horse serum containing 10% fetal bovine serum, 1% L-glutamine (3.6 mM), and 1% penicillin antibiotics and were grown in a 5% CO 2 atmosphere at 37˚C. The primary rat hippocampus cells were cultured on plates which were coated in the fetal bovine serum (Beyotime Institute of Biotechnology) and were cultured at 37˚C in humidified air. Two-thirds of the growing medium was changed every 2-3 days and the cells were subcultured roughly once a week. On day 12 of culturing, the incubation media were replaced with media with H 2 O 2 (3, 30 and 300 µmol/l) to achieve oxidative stress injury. Following incubation for 30 min, NAC was added to the media at concentrations of 1, 10, 100 or 1,000 µmol/l.
+ Open protocol
+ Expand
2

Culturing Human Colon Cancer Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
Human colon cancer cell lines HIEC, LOVO, HCT8, SW620, and HCT116 were provided by the American Type Culture Collection and maintained in RPMI-1640 medium (Thermo Fisher Scientific, Inc.) supplemented with a final concentration of 10% fetal bovine serum and 1% penicillin-streptomycin solution (Beyotime Institute of Biotechnology) in a 5% CO2 incubator at 37°C.
+ Open protocol
+ Expand
3

MCF-7 Cell Culture Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
The human breast cell line MCF-7 (Shanghai Institute of Cell Biology China, catalogue number: SCSP-531) was cultured in DMEM supplemented with 10% fetal bovine serum and 1% penicillin and streptomycin (Beyotime, Shanghai, China). MCF-7 cells were routinely cultured in 5% CO2 at 37 °C.
+ Open protocol
+ Expand
4

Cell Culture Techniques for Hepatocellular Carcinoma

Check if the same lab product or an alternative is used in the 5 most similar protocols
The human HCC cell lines Hep3B and Huh-7 were obtained from the American Type Culture Collection (Manassas, VA) and the Japanese Collection of Research Bioresources (Tokyo, Japan), respectively. GP2-293 cells were purchased from Clontech (BD Biosciences, San Jose, CA). SMMC-7721 cells were purchased from the China Center for Type Culture Collection (Wuhan, China). These cell lines were cultured in Dulbecco’s modified Eagle’s medium (Invitrogen, Carlsbad, CA), containing 10% fetal bovine serum and 1% antibiotic-antimycotic (Beyotime, Haimen, China), at 37°C with 5% CO2. For all studies, vesicle-depleted medium was prepared by centrifuging cell-culture medium at 110,000g overnight to spin down any preexisting vesicular content.9 (link)
+ Open protocol
+ Expand
5

Isolation and Culture of Synovial Fibroblasts

Check if the same lab product or an alternative is used in the 5 most similar protocols
FLS were obtained from the synovium of AIA rats and RA patients by tissue separation and cultured in Dulbecco’s Modified Eagle’s Medium (HyClone, South Logan, UT, United States) supplemented with 20% (v/v) fetal bovine serum, 100 U/ml penicillin, and 100 mg/ml of streptomycin (Beyotime, Shanghai, China) at 37°C and 5% CO2.
+ Open protocol
+ Expand
6

Culturing Bel-7402 Liver Cancer Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
The Bel-7402 cell line was kindly provided by the Science Experimental Center of Liaoning Medical University (Jinzhou, China). Cells were cultured in RPMI-1640 (Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA) supplemented with 10% fetal bovine serum (Beyotime Institute of Biotechnology, Haimen, China) and 100 U/ml streptomycin/penicillin at 37°C in an atmosphere containing 5% CO2. When 80–90% confluence was reached, Bel-7402 cells were digested by 0.25% trypsin (Beyotime Institute of Biotechnology) as previously described (22 (link)) for subsequent experiments.
+ Open protocol
+ Expand
7

Isolation and Culture of Rat Synovial Fibroblasts

Check if the same lab product or an alternative is used in the 5 most similar protocols
Primary RA synovial fibroblasts were isolated from the synovium of male Sprague-Dawley rats weighing 160-180 g purchased from the Beijing Vital River Laboratory Animal Technology Co., Ltd. This study was approved by the Animal Ethics Committee of Peking University First Hospital. The rat model of adjuvant-induced arthritis (AIA) was established according to a previously published protocol (15 (link)). The knees of rat models were embedded in paraffin, sectioned at 5-μm thickness sections, and then stained with hematoxylin and eosin.
The methods of primary synovial fibroblast extraction and culture were based on a previous publication (16 (link)). In order to obtain pure synovial fibroblasts, cells used herein were at passage 3-5. Synovial fibroblasts were cultured in DMEM high-glucose medium (Gibico, America) containing 10% fetal bovine serum (Pan, Germany) and 1% penicillin-streptomycin (Beyotime, China) at 37 °CC in a 5% CO2 incubator.
+ Open protocol
+ Expand
8

Transfection and Gene Expression Analysis in PC12 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
PC12 cells, which are generally used as a neuronal cell line, were cultured in Dulbecco's modified Eagle's medium (DMEM; Gibco, USA) containing 5% heat-inactivated horse serum (Beyotime, China) and 10% fetal bovine serum (PAN, Germany). The cells were incubated in 5% carbon dioxide incubators at 37 °C. During the exponential phase of growth, PC12 cells were cultured in 12-well plates for transfection. The rno-tRFi-Ser-25a mimic (AUGGA-CUGCUAAUCCAUUGUGCUCU), rno-tRFi-Gln-16a mimic (TCTGGACTCTGAATCC), and the negative control (NC; UUUGUACUACACAAAAGUACUG) were obtained from RiboBio (Guangzhou, China). The transfection of mimics and NC was performed using Lipofectamine 3000 (Invitrogen, USA) at a final concentration of 200 nmol, according to the manufacturer’s instructions. All groups were performed in triplicate. After 48 hours of transfection, the transfected cells were harvested for total RNA isolation. The tsRNA-targeted genes were then measured by qPCR. The specific primers are listed in Table 1 and the protocols were as described as above.
+ Open protocol
+ Expand
9

Mechanisms of β-Carotene in Apoptosis

Check if the same lab product or an alternative is used in the 5 most similar protocols

β-Carotene was purchased from MedChem Express (MCE Co., Ltd., Shanghai, China). LPS and rapamycin (RAPA) were obtained from Sigma Company (St. Louis, MO, USA). Culture medium (DMEM) was furnished by Gibco BRL (Carlsbad, CA, USA). Fetal bovine serum, pancreatic digestive juice, DPBS, and CCK-8 kits were supplied by Beyotime Institute of Biotechnology (Haimen, China). The FITC Annexin V apoptosis detection kit I was obtained from BD PharMingen (San Diego, CA). The stubRFP-sensGFP-LC3 adenovirus was provided by JikaiGene (Shanghai, China). Primary antibodies against cleaved caspase-3, Bcl-2, Bax, p62, LC3II/I, p-PI3K, PI3K, p-AKT, AKT, p-mTOR, mTOR, and β-actin were purchased from Wuhan Sanying Biotechnology (Wuhan, China).
+ Open protocol
+ Expand
10

Rg1 Modulates Oxidative Stress in GC-2spd Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
GC-2spd (ts) cells were purchased from Fenghui Biotechnology Co., Ltd. (Hunan, China), and were cultured in Dulbecco's Modified Eagle medium (DMEM) with 10% fetal bovine serum and 1% streptomycin/penicillin (Beyotime, China). After synchronization for 24 h, the cells were treated with Rg1 (50 μM) in the presence or absence of D-gal (40 mg/ml) for 24 h (Additional file 1: Figure S1). For Akt inhibition, GC-2spd (ts) cells were pretreated with Akti (1 μmol/L) for 30 min. To knock down the expression of NRF2, cells were transfected with siNRF2 (100 nmol/L) for 4 h using the Lipofectamine™ 2000 transfection reagent according to the manufacturer's protocol (Thermo Fisher, USA) and then cultured in normal medium for 24 h before the next treatment.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!