CTCs were isolated from fresh blood specimens drawn from patients with prostate cancer, following negative depletion of leukocytes using the microfluidic CTC-iChip as reported previously26 (link),27 (link). Briefly, 10–20 ml of whole blood specimens were incubated with biotinylated antibody cocktails against CD45 (R&D Systems, clone 2D1), CD66b (AbD Serotec, clone 80H3), and CD16 (BD Biosciences), followed by incubation with Dynabeads MyOne Streptavidin T1 (Invitrogen) for magnetic labeling and depletion of leukocytes. After CTC-iChip processing, the CTC-enriched product was further stained with FITC-conjugated antibody against EpCAM (Cell Signaling Technology, clone VU1D9) and PE-conjugated antibody against CD45 (BD Biosciences, clone HI30). Single CTCs (FITC positive and PE negative) or white blood cells (WBCs, FITC negative and PE positive) were individually picked into PCR tubes containing 5 μl RNA/DNA lysis buffer using micromanipulator (Eppendorf TransferMan NK 2) and snap-frozen in liquid nitrogen. In total, 38 CTCs from 5 different patients (GU114, GU169, GU181, GU216 and GURa15) with metastatic prostate cancer were individually picked, sequenced and lineage-confirmed based on transcriptome and DNA copy number. One patient sample (GU169) had only one CTC, and it was therefore excluded from some downstream analyses focused on the four patients with multiple CTCs.
Transferman nk2
Manufactured by Eppendorf
Sourced in Germany, Japan
The TransferMan NK2 is a micromanipulator instrument designed for precise and controlled cell handling and microinjection applications in research laboratories. It provides precise control over the movement and positioning of micropipettes for delicate cell manipulation tasks.
Automatically generated - may contain errors
Lab products found in correlation
Femtojet, by Eppendorf (6 mentions)
Celltram vario, by Eppendorf (4 mentions)
Femtojet 5247, by Eppendorf (3 mentions)
Eclipse ti, by Nikon (3 mentions)
Clone 80h3, by BD (2 mentions)
Vu1d9, by BD (2 mentions)
Dynabeads myone streptavidin t1, by Thermo Fisher Scientific (2 mentions)
Clone 2d1, by Bio-Rad (2 mentions)
Szx16 microscope, by Olympus (2 mentions)
Milrinone, by Eppendorf (2 mentions)
M7167, by Merck Group (2 mentions)
T7 mscript standard mrna production system, by CellScript (2 mentions)
Ix70 fluorescence microscope cutaway, by Olympus (2 mentions)
Femtojet 4i, by Eppendorf (2 mentions)
Celltram oil, by Eppendorf (2 mentions)
Piezoxpert, by Eppendorf (2 mentions)
Dmi6000b, by Leica (2 mentions)
Celltram air, by Eppendorf (2 mentions)
Tcs sp5 microscope, by Leica (1 mentions)
P50g 0 14 f, by Leica (1 mentions)
54 protocols using transferman nk2
1
Isolation and Sequencing of Individual Prostate Cancer CTCs
2
Microinjection of dsRNA and siRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Microinjection was performed in M2 medium using a Nikon inverted microscope equipped with a piezo-driven (Prime Tech, Japan) micromanipulator (TransferMan NK2, Eppendorf, Hamburg, Germany). A volume of 5–10 pl dsRNA (3 μg/μl) was microinjected into the cytoplasm of zygotes using a blunt-ended pipette of 6–7 μm in diameter. The same concentration and volume of dsGFP was injected as control in all experiments. For siRNA experiment, 5–10 pl (100 μM) of control or gene specific siRNA was microinjected into the cytoplasm of zygotes using same method as described above. After microinjection, zygotes were washed with M2 medium and cultured in KSOM medium at 37 °C in a humidified atmosphere of 5% CO2/5% O2 balanced in N2.
3
Oriented Collagen Fibril Placement
4
Microinjection of dsNop2 and siRNA in Zygotes
5
Oocyte Microinjection for Oxidative Stress
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Fully grown GV oocytes were microinjected with between 5-10 pl Pol β siRNA (50 μM, GenePharma) or Pol β cDNA(1 mg/ml, GenePharma) via Eppendorf FemtoJet (Eppendorf AG) while being observed under a Leica inverted microscope (M50, Kramer Scientific) along with an Eppendorf TransferMan NK2 micromanipulator. Injected oocytes were grown using HTF media containing 0.4% bovine serum albumin (BSA) for 8 h, followed by treatment with 250 μM H2O2 for 5 min at 4° C, and then oocytes were washed three times for 2 min each using fresh human tubal fluid (HTF). Oocytes were transferred into fresh HTF and grown under paraffin oil at 37° C in a 5% CO2 incubator. As controls, oocytes were instead microinjected with 5 to 10 pl of “All Stars Negative siRNA” from GenePharma (50 μM). Oocyte survival was assessed based on established morphological criteria [50 (link)]. The oocytes that survived were stained for AC3 and assessed via microscopy.
6
Isolation of Genital Ridge Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genital ridges from Oct4-GFP transgenic embryos
[43 (link)] were isolated from 9.5–13.5 dpc embryos then treated with trypsin, and single GFP-positive cells were collected manually using an inverted fluorescence microscope Zeiss AxioVert 200 M and micromanipulators (TransferMan NK2; Eppendorf, Germany). The sex of the embryos at 13.5 dpc was determined by the arrangement of the PGCs in the gonad. Each sample contained at least 40 PGCs. As a control, we collected GFP-negative cells from 9.5 dpc embryos.
[43 (link)] were isolated from 9.5–13.5 dpc embryos then treated with trypsin, and single GFP-positive cells were collected manually using an inverted fluorescence microscope Zeiss AxioVert 200 M and micromanipulators (TransferMan NK2; Eppendorf, Germany). The sex of the embryos at 13.5 dpc was determined by the arrangement of the PGCs in the gonad. Each sample contained at least 40 PGCs. As a control, we collected GFP-negative cells from 9.5 dpc embryos.
7
Silkworm Embryo Microinjection Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A diapausing strain, Dazao, which is wildly used as a wild type silkworm, was utilized in this study. The larvae were reared with fresh mulberry leaves at 25°C, 75% RH. Parental embryos (P) were incubated at 15°C and 75% RH to produce nondiapusing eggs (G0), which are suitable for microinjection. The microinjections were performed utilizing TransferMan NK2 micromanipulator and Femto Jet 5247 microinjector (Eppendorf) under an SZX16 microscope (Olympus) as we reported previously [11 (link)]. For transient assays, embryos were injected within 5 hours after oviposition and harvested 3 days post injections. For germline assays such as heritable chromosomal deletion using TALEN-B3 and ssODN B3-794, embryos were injected within 2 hours after oviposition and allowed to develop to moths. Mosaic mutations were observed as early as the 3rd instar. The resulting G0 males were first crossed with G0 females and the remaining uncopulated G0 males were crossed with wild-type females. The G1 mutations were checked for the translucent skin phenotype on the 3rd instar, and all the positive mutations were allowed to develop to the moths.
8
Mouse Oocyte Microinjection Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Mus musculus mice (CF-1 strain) were purchased from Envigo NSA stock # 033. Females were primed with 5 U of pregnant mare somatic gonadotropin (367222; Calbiochem) injected into the intraperitoneal cavity 44–48 h prior to oocyte collections to induce superovulation. The ovaries were isolated using M2 medium (M7167; Sigma-Aldrich) supplemented with 2.5 mM of the maturation-blocking phosphodiesterase 3 inhibitor milrinone (M4659; 2.5 mM; Sigma-Aldrich Milipore). Germinal-vesicle oocytes were collected, denuded mechanically from cumulus cells, and incubated for at least 1 h prior to microinjection on a hot plate (38°C) under mineral oil (9305; FUJIFILM Irvine Scientific). Oocytes were then microinjected with ∼5 pl of mRNAs in M2 medium with 2.5 mM milrinone and 3 mg/ml BSA at RT with a micromanipulator TransferMan NK 2 (Eppendorf) and a picoinjector (Medical Systems Corp). Oocytes were then incubated in 30–50 μl drops of Chatot-Ziomek-Bavister medium (MR019D; Thermo Fisher Scientific) under mineral oil (M5310; Sigma-Aldrich Milipore) at 37.8°C and 5% CO2 (Airgas) for 16 h to allow protein expression. The concentration of mRNA (15–30 ng/μl) used was selected to ensure similar cytoplasmic expression. mRNAs were synthesized using the T7 mScriptTM Standard mRNA Production System (C-MSC100625; CELLSCRIPT).
9
Oocyte Cortical Tension Measurement
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cortical tension measurements52 were performed using dechorionated oocytes placed in a gelatine-coated MatTek dish (MatTek, P50G-0-14-F) on an inverted Leica TCS SP5 microscope. Blunt, fire-polished and heat-inactivated fetal bovine serum-passivated (Fisher Scientific, 15961842) micropipettes with a 20 µm inner diameter (Biomedical Instruments) and a 30° bent angle were positioned by micromanipulators (TransferMan Nk2, Eppendorf) at the surface of the AP or VP of unfertilized oocytes. A negative pressure was applied with an increment of 10 Pa using a Microfluidic Flow Control System Pump (Fluiwell, Fluigent) and Dikeria micromanipulation software53 . Images were acquired every second. The length of the deformation inside the pipette was measured in Fiji54 (link) using a customized macro and plotted over time. Cortical (or surface) tension (Tc) was calculated using the Young–Laplace equation:
Pc is the critical pressure reached when the deformation inside the pipette is equal to the pipette radius (Rp); Rc is the radius of the oocyte at the initial aspiration time point. Controls were performed with pipettes of different sizes (10, 20, 35 and 40 µm) (Extended Data Fig.5c ).
Pc is the critical pressure reached when the deformation inside the pipette is equal to the pipette radius (Rp); Rc is the radius of the oocyte at the initial aspiration time point. Controls were performed with pipettes of different sizes (10, 20, 35 and 40 µm) (Extended Data Fig.
10
Microinjection of Oocytes for Meiosis Imaging
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Isolated NE oocytes were microinjected in TM with IBMX using inverted microscope Leica DMI 6000B, TransferMan NK2 (Eppendorf) and FemtoJet (Eppendorf). Solution used for oocyte injection contained: 20 ng/µL of in vitro transcribed H2b:gfp RNA (mMessage, Ambion) from plasmid (provided by Dr. Martin Anger, Laboratory of Cell Division Control, IAPG CAS) in combination with 1 mM morpholinos (control: CCTCTTACCTCAGTTACAATTTATA and Ank2.3: TGTGACTGCCTGTCTACCATCAAAC; Gene Tools) - to block translation of Ank2.3 mRNA. 1.5 h after microinjection oocytes were washed from IBMX and cultivated to MII stage. Microinjected oocytes were placed into 4-well culture chamber (Sarstedt) in 10 µL of equilibrated M16 media (37.5 °C, 5% CO2) covered with mineral oil (M8410; Sigma Aldrich). The cells were imaged using inverted microscope Leica DMI 6000B equipped with a controlled chamber system (Tempcontroller 2000–2 Pecon, and a CO2 controller, Pecon). Time lapse movies (LAS X, Leica microsystems) of meiotic maturation of microinjected oocytes with chromatin marker (H2b:gfp) and morpholinos were used for phenotype evaluation (nuclear envelope breakdown, polar body extrusion).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!